diff --git a/.github/workflows/ci.yml b/.github/workflows/ci.yml
index 1e38360..1bd7dde 100644
--- a/.github/workflows/ci.yml
+++ b/.github/workflows/ci.yml
@@ -19,10 +19,10 @@ jobs:
- uses: actions/checkout@v4
- name: Install Pixi
- uses: prefix-dev/setup-pixi@v0.8.3
+ uses: prefix-dev/setup-pixi@v0.9.6
with:
environments: format
- pixi-version: v0.43.3
+ pixi-version: v0.69.0
cache: false
locked: false
@@ -47,10 +47,10 @@ jobs:
fetch-depth: 0
- name: Install Pixi
- uses: prefix-dev/setup-pixi@v0.8.3
+ uses: prefix-dev/setup-pixi@v0.9.6
with:
environments: test
- pixi-version: v0.43.3
+ pixi-version: v0.69.0
cache: false
locked: false
diff --git a/README.md b/README.md
index c0f6382..0bf8551 100644
--- a/README.md
+++ b/README.md
@@ -1,6 +1,6 @@
# aeDNA - a customizable Snakemake workflow for ancient environmental DNA
-[](https://snakemake.bitbucket.io)
+[](https://snakemake.bitbucket.io)

This workflow combines several modules to build a workflow for ancient environmental DNA (aeDNA) analyses and QC:
diff --git a/examples/README.md b/examples/README.md
index eb11d8f..90468c3 100644
--- a/examples/README.md
+++ b/examples/README.md
@@ -15,6 +15,23 @@
+# DRAGEN - 1 sample (simulated) over 2 reference collections
+Rulegraph
+
+
+
+
+DAG
+
+
+
+
+Filegraph
+
+
+
+
+
# Empty - 1 negative control
Rulegraph
diff --git a/examples/dragen/config/config.yaml b/examples/dragen/config/config.yaml
new file mode 100644
index 0000000..34ba6ac
--- /dev/null
+++ b/examples/dragen/config/config.yaml
@@ -0,0 +1,137 @@
+
+# - Only tested with Phred33 quality scores
+
+samples: config/samples.tsv
+
+units: config/units.tsv
+
+
+
+#############
+### READS ###
+#############
+trim:
+ trim:
+ activate: true
+ tool: adapterremoval
+ params: "--trimns --maxns 10 --trimqualities --minlength 30 --mask-degenerate-bases --seed 12345"
+
+ # Ignored for SE
+ collapse:
+ activate: true
+ params: "--collapse-conservatively"
+
+derep:
+ extension:
+ activate: false
+ k: 16
+ params: "ibb=t prefilter=0 el=100 er=100 ecc=f ecco=f ignorebadquality extendrollback=0"
+
+ derep:
+ activate: true
+ # vsearch or seqkit
+ tool: seqkit
+ params: ""
+
+ low_complex:
+ params: "entropy=0.7 entropywindow=30 entropyk=4"
+
+
+
+#############
+### ALIGN ###
+#############
+prefilter:
+ taxa: "Bacteria,Archaea,Viruses"
+
+ taxonomy:
+ nodes: "data/taxdump/nodes.dmp"
+ names: "data/taxdump/names.dmp"
+
+ ref:
+ hires_organelles_viruses_smags:
+ n_shards: 2
+ path: "/staging/hash_tables/hires-organelles-viruses-smags.{n_shard}"
+ map:
+ tool: dragen
+ params: "--Mapper.edit-mode=1"
+ acc2taxid: "data/prok.acc2taxid.gz"
+ human_genome:
+ n_shards: 1
+ path: "/staging/hash_tables/GCF_000001405.40_GRCh38.p14_genomic"
+ map:
+ tool: dragen
+ params: "--Aligner.global=1 --Aligner.match-score=0 --Aligner.match-n-score=-1 --Aligner.mismatch-pen=4 --Aligner.gap-open-pen=0 --Aligner.gap-ext-pen=4 --Aligner.aln-min-score=0 --Aligner.min-score-coeff=-0.4 --Aligner.sec-aligns=2000 --Aligner.supp-aligns=0 --Aligner.hard-clips=0 --Aligner.sec-score-delta=100 --Mapper.edit-mode=1 --Mapper.max-seed-freq=256 --Mapper.reduce-seed-ext=1 --Mapper.intvl-target-hits=256 --Mapper.intvl-max-hits=256 --Mapper.intvl-sample-hits=256 --Mapper.seed-density=1.0 --Mapper.edit-seed-num=80 --Mapper.edit-read-len=100 --Mapper.edit-chain-limit=29 --filter-flags-from-output=4"
+ acc2taxid: "data/human.acc2taxid.gz"
+
+ filter:
+ saturated_reads:
+ activate: true
+ n_alns: 500
+
+ unicorn:
+ refstats:
+ params: "--minrefl 1 --minreads 1 --rank genus"
+ taxstats:
+ params: "-k 17 --minrefl 1 --minreads 1 --minmani 0 --minalnas -Inf --maxdust 100"
+
+ metadmg:
+ damage:
+ params: "--print_length 15"
+
+ lca:
+ params: "--fix_ncbi 0 --how_many 25 --weight_type 1 --edit_dist_max 10000 --lca_rank genus"
+
+ dfit:
+ params: "--nopt 5 --showfits 2"
+
+
+euk:
+ taxonomy:
+ nodes: "data/taxdump/nodes.dmp"
+ names: "data/taxdump/names.dmp"
+
+ ref:
+ refseq_mitoch:
+ n_shards: 1
+ path: "/staging/hash_tables/refseq_mitochondrion.genomic/"
+ map: &map_euk_dragen
+ tool: dragen
+ params: "--Aligner.global=1 --Aligner.match-score=0 --Aligner.match-n-score=-1 --Aligner.mismatch-pen=4 --Aligner.gap-open-pen=0 --Aligner.gap-ext-pen=4 --Aligner.aln-min-score=0 --Aligner.min-score-coeff=-0.4 --Aligner.sec-aligns=2000 --Aligner.supp-aligns=0 --Aligner.hard-clips=0 --Aligner.sec-score-delta=100 --Mapper.edit-mode=0 --Mapper.max-seed-freq=256 --Mapper.reduce-seed-ext=1 --Mapper.intvl-target-hits=256 --Mapper.intvl-max-hits=256 --Mapper.intvl-sample-hits=256 --Mapper.seed-density=1.0 --Mapper.edit-seed-num=80 --Mapper.edit-read-len=100 --Mapper.edit-chain-limit=29 --filter-flags-from-output=4"
+ acc2taxid: "data/mitoch.acc2taxid.gz"
+ core_nt:
+ n_shards: 4
+ path: "/staging/hash_tables/core_nt.{n_shard}"
+ map:
+ <<: *map_euk_dragen
+ acc2taxid: "data/core_nt.acc2taxid.gz"
+
+ filter:
+ saturated_reads:
+ activate: true
+ n_alns: 500
+
+ unicorn:
+ refstats:
+ params: "--minrefl 1 --minreads 1 --rank genus"
+ taxstats:
+ params: "-k 17 --minrefl 1 --minreads 1 --minmani 0 --minalnas -Inf --maxdust 100"
+
+
+ metadmg:
+ damage:
+ params: "--print_length 15"
+
+ lca:
+ params: "--fix_ncbi 0 --how_many 15 --sim_score_low 0.95 --weight_type 0 --edit_dist_max 10000 --lca_rank genus"
+
+ dfit:
+ params: "--nopt 5 --showfits 2 --seed 12345"
+
+
+############
+## REPORT ##
+############
+report:
+ multiqc: "--no-ai --verbose --cl-config 'custom_logo: data/KU_long.png' --cl-config 'custom_logo_title: CAEG - Center for Ancient Environmental Genomics' --cl-config 'custom_logo_url: https://globe.ku.dk/research/caeg/'"
+ multiqc_db_url: "test_qc.sqlite"
diff --git a/examples/dragen/config/samples.tsv b/examples/dragen/config/samples.tsv
new file mode 100644
index 0000000..5994081
--- /dev/null
+++ b/examples/dragen/config/samples.tsv
@@ -0,0 +1,2 @@
+sample alias group condition
+Lib ancient
diff --git a/examples/dragen/config/units.tsv b/examples/dragen/config/units.tsv
new file mode 100644
index 0000000..4a8a376
--- /dev/null
+++ b/examples/dragen/config/units.tsv
@@ -0,0 +1,4 @@
+sample library flowcell lane seq_type library_type material data machine run_n sample_n date center platform adapters
+Lib LVsim1 BHXXXXXXXX L001 PE ds DNA data/test_L001_R{Read}.fq.gz SIMULATED 0000 S1 2025-10-09 CAEG ILLUMINA AGATCGGAAGAGCACACGTCTGAACTCCAGTCA,AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT
+Lib LVsim1 BHXXXXXXXX L002 PE ds DNA data/test_L002_R{Read}.fq.gz SIMULATED 0000 S2 2025-10-09 CAEG ILLUMINA AGATCGGAAGAGCACACGTCTGAACTCCAGTCA,AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT
+Lib LVsim2 BHXXXXXXXX L001 PE ds DNA data/test_L003_R{Read}.fq.gz SIMULATED 0000 S3 2025-10-09 CAEG ILLUMINA AGATCGGAAGAGCACACGTCTGAACTCCAGTCA,AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT
diff --git a/examples/dragen/dag.svg b/examples/dragen/dag.svg
new file mode 100644
index 0000000..c868f81
--- /dev/null
+++ b/examples/dragen/dag.svg
@@ -0,0 +1,3158 @@
+
+
+
+
+
diff --git a/examples/dragen/data/KU_long.png b/examples/dragen/data/KU_long.png
new file mode 100644
index 0000000..1a64e0e
Binary files /dev/null and b/examples/dragen/data/KU_long.png differ
diff --git a/examples/dragen/data/core_nt.acc2taxid.gz b/examples/dragen/data/core_nt.acc2taxid.gz
new file mode 100644
index 0000000..85ed6ea
Binary files /dev/null and b/examples/dragen/data/core_nt.acc2taxid.gz differ
diff --git a/examples/dragen/data/human.acc2taxid.gz b/examples/dragen/data/human.acc2taxid.gz
new file mode 100644
index 0000000..5e59800
Binary files /dev/null and b/examples/dragen/data/human.acc2taxid.gz differ
diff --git a/examples/dragen/data/mitoch.acc2taxid.gz b/examples/dragen/data/mitoch.acc2taxid.gz
new file mode 100644
index 0000000..a457cd4
Binary files /dev/null and b/examples/dragen/data/mitoch.acc2taxid.gz differ
diff --git a/examples/dragen/data/prok.acc2taxid.gz b/examples/dragen/data/prok.acc2taxid.gz
new file mode 100644
index 0000000..5dbe5f2
Binary files /dev/null and b/examples/dragen/data/prok.acc2taxid.gz differ
diff --git a/examples/dragen/data/taxdump/names.dmp b/examples/dragen/data/taxdump/names.dmp
new file mode 100644
index 0000000..a2db560
--- /dev/null
+++ b/examples/dragen/data/taxdump/names.dmp
@@ -0,0 +1,6450 @@
+1 | all | | synonym
+1 | root | | scientific name
+2 | "Bacteria" Cavalier-Smith 1987 | | authority
+2 | "Bacteriobiota" Luketa 2012 | | authority
+2 | Bacteria | Bacteria | scientific name
+2 | Bacteria (ex Cavalier-Smith 1987) | | synonym
+2 | Bacteria Woese et al. 2024 | | synonym
+2 | Bacteriobiota | | synonym
+2 | Monera | Monera | in-part
+2 | Procaryotae | Procaryotae | in-part
+2 | Prokaryota | Prokaryota | in-part
+2 | Prokaryotae | Prokaryotae | in-part
+2 | bacteria | bacteria | blast name
+2 | bacteria | bacteria | genbank common name
+2 | eubacteria | | common name
+2 | prokaryote | prokaryote | in-part
+2 | prokaryotes | prokaryotes | in-part
+543 | Enterobacteraceae | | synonym
+543 | Enterobacteraceae (ex Lapage 1979) Lapage 1982 | | authority
+543 | Enterobacteriaceae | | scientific name
+543 | Enterobacteriaceae (ex Rahn 1937) Ewing et al. 1980 | | authority
+543 | Enterobacteriaceae Rahn 1937 (Approved Lists 1980) emend. Adeolu et al. 2016 | | authority
+543 | enterobacteria | enterobacteria | blast name
+543 | enterobacteria | enterobacteria | genbank common name
+543 | gamma-3 proteobacteria | gamma-3 proteobacteria | in-part
+548 | "Aerobacter aerogenes" Hormaeche and Edwards 1958 | | authority
+548 | ATCC 13048 | ATCC 13048 | type material
+548 | Aerobacter aerogenes | | synonym
+548 | CCUG 1429 | CCUG 1429 | type material
+548 | CIP 60.86 | CIP 60.86 | type material
+548 | DSM 30053 | DSM 30053 | type material
+548 | Enterobacter aerogenes | | synonym
+548 | Enterobacter aerogenes Hormaeche and Edwards 1960 | | authority
+548 | HAMBI 101 | HAMBI 101 | type material
+548 | HAMBI 1898 | HAMBI 1898 | type material
+548 | IFO 13534 | IFO 13534 | type material
+548 | JCM 1235 | JCM 1235 | type material
+548 | KCTC 2190 | KCTC 2190 | type material
+548 | Klebsiella aerogenes | | scientific name
+548 | Klebsiella aerogenes (Hormaeche and Edwards 1960) Tindall et al. 2017 | | authority
+548 | Klebsiella mobilis | | synonym
+548 | Klebsiella mobilis Bascomb et al. 1971 | | authority
+548 | LMG 2094 | LMG 2094 | type material
+548 | LMG:2094 | LMG:2094 | type material
+548 | NBRC 13534 | NBRC 13534 | type material
+548 | NCAIM B.01467 | NCAIM B.01467 | type material
+548 | NCTC 10006 | NCTC 10006 | type material
+568 | Hafnia | | scientific name
+568 | Hafnia Moller 1954 | | authority
+570 | "Donovania" Anderson et al. 1944 | | authority
+570 | "Hyalococcus" Schroeter 1886 | | authority
+570 | Calymmatobacterium | | synonym
+570 | Calymmatobacterium Aragao and Vianna 1913 | | authority
+570 | Donovania | | synonym
+570 | Hyalococcus | | synonym
+570 | Klebsiella | | scientific name
+570 | Klebsiella Trevisan 1885 (Approved Lists 1980) | | authority
+570 | Klebsiella Trevisan 1885 (Approved Lists 1980) emend. Carter et al. 1999 | | authority
+570 | Klebsiella Trevisan 1885 (Approved Lists 1980) emend. Drancourt et al. 2001 | | authority
+570 | Klebsiella Trevisan 1885 (Approved Lists 1980) emend. Ma et al. 2021 | | authority
+573 | "Bacillus pneumoniae" (Schroeter 1886) Flugge 1886 | | authority
+573 | "Bacterium pneumoniae crouposae" Zopf 1885 | | authority
+573 | "Hyalococcus pneumoniae" Schroeter 1886 | | authority
+573 | 'Klebsiella aerogenes' (Kruse) Taylor et al. 1956 | | synonym
+573 | ATCC 13883 | ATCC 13883 | type material
+573 | Bacillus pneumoniae | | synonym
+573 | Bacterium pneumoniae crouposae | | synonym
+573 | CCUG 225 | CCUG 225 | type material
+573 | CDC 298-53 | CDC 298-53 | type material
+573 | CIP 82.91 | CIP 82.91 | type material
+573 | DSM 30104 | DSM 30104 | type material
+573 | HAMBI 450 | HAMBI 450 | type material
+573 | Hyalococcus pneumoniae | | synonym
+573 | IAM 14200 | IAM 14200 | type material
+573 | IFO 14940 | IFO 14940 | type material
+573 | JCM 1662 | JCM 1662 | type material
+573 | Klebsiella pneumoniae | | scientific name
+573 | Klebsiella pneumoniae (Schroeter 1886) Trevisan 1887 | | authority
+573 | Klebsiella pneumoniae aerogenes | | synonym
+573 | Klebsiella sp. 2N3 | | includes
+573 | Klebsiella sp. C1(2016) | | includes
+573 | Klebsiella sp. M-AI-2 | | includes
+573 | Klebsiella sp. PB12 | | includes
+573 | Klebsiella sp. RCE-7 | | includes
+573 | LMG 2095 | LMG 2095 | type material
+573 | LMG:2095 | LMG:2095 | type material
+573 | NBRC 14940 | NBRC 14940 | type material
+573 | NCTC 9633 | NCTC 9633 | type material
+574 | "Bacillus mucosus azaenae" Abel 1893 | | authority
+574 | "Bacillus ozaenae" Abel 1893 | | authority
+574 | "Bacterium ozaenae" (Abel 1893) Lehmann and Neumann 1896 | | authority
+574 | ATCC 11296 | ATCC 11296 | type material
+574 | Bacillus mucosus azaenae | | synonym
+574 | Bacillus ozaenae | | synonym
+574 | Bacterium ozaenae | | synonym
+574 | CCUG 15938 | CCUG 15938 | type material
+574 | CIP 52.211 | CIP 52.211 | type material
+574 | DSM 16358 | DSM 16358 | type material
+574 | JCM 1663 | JCM 1663 | type material
+574 | Klebsiella ozaenae | | synonym
+574 | Klebsiella ozaenae (Abel 1893) Bergey et al. 1925 (Approved Lists 1980) | | authority
+574 | Klebsiella pneumoniae (SUBSP. OZAENAE) | | synonym
+574 | Klebsiella pneumoniae ozaenae | | synonym
+574 | Klebsiella pneumoniae subsp. ozaenae | | scientific name
+574 | Klebsiella pneumoniae subsp. ozaenae (Abel 1893) Orskov 1984 | | authority
+574 | Klebsiella sp. VTT E-96667 | | includes
+574 | LMG 3113 | LMG 3113 | type material
+574 | LMG:3113 | LMG:3113 | type material
+574 | NBRC 105683 | NBRC 105683 | type material
+574 | NBRC-105683 | NBRC-105683 | type material
+574 | NBRC105683 | NBRC105683 | type material
+574 | NBRC:105683 | NBRC:105683 | type material
+574 | NCTC 5050 | NCTC 5050 | type material
+1224 | "Alphaproteobacteriota" Whitman et al. 2018 | | synonym
+1224 | "Proteobacteria" Garrity et al. 2005 | | authority
+1224 | "Proteobacteriota" Panda et al. 2022 | | authority
+1224 | Alphaproteobacteriota | | synonym
+1224 | Proteobacteria | | synonym
+1224 | Proteobacteria Stackebrandt et al. 1988 | | authority
+1224 | Proteobacteriota | | synonym
+1224 | Pseudomonadota | | scientific name
+1224 | Pseudomonadota corrig. Garrity et al. 2021 | | authority
+1224 | proteobacteria | proteobacteria | blast name
+1224 | proteobacteria | proteobacteria | genbank common name
+1224 | purple photosynthetic bacteria and relatives | | common name
+1236 | "Pseudomonadia" Oren et al. 2016 | | authority
+1236 | Gammaproteobacteria | | scientific name
+1236 | Gammaproteobacteria Garrity et al. 2005 emend. Williams and Kelly 2013 | | authority
+1236 | Proteobacteria gamma subdivision | | synonym
+1236 | Pseudomonadia | | synonym
+1236 | Purple bacteria, gamma subdivision | | synonym
+1236 | g-proteobacteria | g-proteobacteria | blast name
+1236 | g-proteobacteria | g-proteobacteria | genbank common name
+1236 | gamma proteobacteria | | synonym
+1236 | gamma subdivision | | synonym
+1236 | gamma subgroup | | synonym
+2157 | "Archaea" Woese et al. 1990 | | authority
+2157 | "Archaebacteria" (sic) Woese and Fox 1977 | | authority
+2157 | "Archaebiota" Luketa 2012 | | authority
+2157 | Archaea | | scientific name
+2157 | Archaea Woese et al. 2024 | | authority
+2157 | Archaebacteria | | synonym
+2157 | Archaebiota | | synonym
+2157 | Mendosicutes | | synonym
+2157 | Metabacteria | | synonym
+2157 | Monera | Monera | in-part
+2157 | Procaryotae | Procaryotae | in-part
+2157 | Prokaryota | Prokaryota | in-part
+2157 | Prokaryotae | Prokaryotae | in-part
+2157 | archaea | | blast name
+2157 | prokaryote | prokaryote | in-part
+2157 | prokaryotes | prokaryotes | in-part
+2235 | "Haloarchaeales" DasSarma and DasSarma 2008 | | authority
+2235 | Haloarchaeales | | synonym
+2235 | Halobacteriales | | scientific name
+2235 | Halobacteriales Grant and Larsen 1989 | | authority
+2235 | Halobacteriales Grant and Larsen 1989 emend. Gupta et al. 2015 | | authority
+2235 | Haloferacales | | synonym
+2235 | Haloferacales Gupta et al. 2015 | | authority
+2235 | Natrialbales | | synonym
+2235 | Natrialbales Gupta et al. 2015 | | authority
+2759 | Eucarya | | synonym
+2759 | Eucaryotae | | synonym
+2759 | Eukarya | | synonym
+2759 | Eukaryota | | scientific name
+2759 | Eukaryotae | | synonym
+2759 | eukaryotes | eukaryotes | blast name
+2759 | eukaryotes | eukaryotes | genbank common name
+2763 | Rhodophyceae | | synonym
+2763 | Rhodophycota | | synonym
+2763 | Rhodophyta | | scientific name
+2763 | algae | algae | in-part
+2763 | red algae | red algae | blast name
+2763 | red algae | red algae | genbank common name
+2763 | rhodophytes | | common name
+2781 | Gracilariopsis | | scientific name
+2781 | Gracilariopsis E.Y.Dawson, 1949 | | authority
+2806 | Florideophyceae | | scientific name
+2806 | Florideophycideae | | synonym
+2870 | Chromophycota | | synonym
+2870 | Fucophyceae | | synonym
+2870 | Phaeophyceae | | scientific name
+2870 | Phaeophyta | | synonym
+2870 | algae | algae | in-part
+2870 | brown algae | brown algae | blast name
+2870 | brown algae | brown algae | genbank common name
+2886 | Laminariales | | scientific name
+2887 | Alariaceae | | scientific name
+2888 | Alaria | Alaria | scientific name
+3041 | Chlorophycota | | synonym
+3041 | Chlorophyta | | scientific name
+3041 | Chlorophyta Pascher, 1914 | | authority
+3041 | Chlorophyta sensu Bremer 1985 | | synonym
+3041 | Prasinophyceae | | includes
+3041 | algae | algae | in-part
+3041 | green algae | green algae | blast name
+3041 | green algae | green algae | genbank common name
+3041 | prasinophyte clade VII | | includes
+3041 | prasinophytes | prasinophytes | in-part
+3166 | Chlorophyceae | | scientific name
+3166 | Chlorophyceae Christensen, 1994 | | authority
+3176 | Zygnematales | | scientific name
+3176 | Zygnematales C.E.Bessey, 1907 | | authority
+3178 | Zygnemataceae | | scientific name
+3178 | Zygnemataceae Kuetzing, 1843 | | authority
+3193 | Embryophyta | | scientific name
+3193 | higher plants | | common name
+3193 | land plants | land plants | blast name
+3193 | land plants | land plants | genbank common name
+3193 | plants | | common name
+3208 | Bryophyta | | scientific name
+3208 | Musci | | synonym
+3208 | bryophytes | bryophytes | in-part
+3208 | mosses | mosses | blast name
+3208 | mosses | mosses | genbank common name
+3214 | Bryopsida | | scientific name
+3214 | Bryopsida Pax, 1900 | | authority
+3296 | Cycadophyta | | equivalent name
+3296 | Cycadopsida | | scientific name
+3296 | cycads | | genbank common name
+3297 | Cycadales | | scientific name
+3297 | Cycadales Pers. ex Bercht. & J.Presl, 1820 | | authority
+3313 | Coniferales | | synonym
+3313 | Pinidae | | scientific name
+3313 | Pinidae Cronquist, Takht. & Zimmerm., 1966 | | authority
+3394 | Cycadaceae | | scientific name
+3394 | Cycadaceae Pers., 1807 | | authority
+3395 | Cycas | | scientific name
+3395 | Cycas L. | | authority
+3395 | Epicycas | | synonym
+3395 | Epicycas de Laub. | | authority
+3398 | Angiospermae | | synonym
+3398 | Magnoliophyta | | synonym
+3398 | Magnoliopsida | | scientific name
+3398 | angiosperms | | common name
+3398 | flowering plants | flowering plants | blast name
+3398 | flowering plants | flowering plants | genbank common name
+3400 | Magnoliales | | scientific name
+3400 | Magnoliales Bromhead, 1838 | | authority
+3400 | Magnolianae | | in-part
+3400 | Magnoliineae | | includes
+3401 | Magnoliaceae | | scientific name
+3401 | Magnoliaceae Juss., 1789 | | authority
+3401 | magnolia family | | common name
+3402 | Alcimandra | | synonym
+3402 | Alcimandra Dandy, 1927 | | authority
+3402 | Aromadendron | | synonym
+3402 | Aromadendron Blume, 1825 | | authority
+3402 | Dugandiodendron | | synonym
+3402 | Dugandiodendron Lozano, 1975 | | authority
+3402 | Elmerrillia | | synonym
+3402 | Elmerrillia Dandy, 1927 | | authority
+3402 | Kmeria | | synonym
+3402 | Kmeria Dandy, 1927 | | authority
+3402 | Lirianthe | | synonym
+3402 | Lirianthe Spach, 1839 | | authority
+3402 | Magnolia | | scientific name
+3402 | Magnolia L., 1753 | | authority
+3402 | Michelia | | synonym
+3402 | Michelia L., 1753 | | authority
+3402 | Pachylarnax | | synonym
+3402 | Pachylarnax Dandy, 1927 | | authority
+3402 | Parakmeria | | synonym
+3402 | Parakmeria Hu & W.C.Cheng, 1951 | | authority
+3402 | Talauma | | synonym
+3402 | Talauma Juss., 1789 | | authority
+3402 | Tsoongiodendron | | includes
+3440 | Ranunculaceae | | scientific name
+3440 | Ranunculaceae Juss., 1789 | | authority
+3440 | buttercup family | | common name
+3487 | Moraceae | | scientific name
+3487 | Moraceae Gaudich., 1835 | | authority
+3487 | mulberry family | | common name
+3502 | Casuarinales | | includes
+3502 | Casuarinales Bercht. & J. Presl, 1820 | | authority
+3502 | Fagales | | scientific name
+3502 | Fagales Engl., 1892 | | authority
+3502 | Juglandales | | includes
+3502 | Juglandales Bercht. & J. Presl, 1820 | | authority
+3502 | Myricineae | | includes
+3503 | Fagaceae | | scientific name
+3503 | Fagaceae Dumort., 1829 | | authority
+3503 | beech family | | common name
+3511 | Quercus | | scientific name
+3511 | Quercus L. | | authority
+3524 | Caryophyllales | | scientific name
+3524 | Caryophyllales Juss. ex Bercht. & J.Presl, 1820 | | authority
+3524 | Centrospermae | | synonym
+3524 | Nepenthineae | | includes
+3524 | Physenales | | includes
+3524 | Polygonales | | includes
+3650 | Cucurbitaceae | | scientific name
+3650 | Cucurbitaceae Juss., 1789 | | authority
+3650 | cucumber family | | common name
+3669 | Luffa | | scientific name
+3669 | Luffa Mill., 1754 | | authority
+3744 | Rhamnales | | includes
+3744 | Rosales | | scientific name
+3744 | Rosales Bercht. & J.Presl, 1820 | | authority
+3744 | Rosanae | | includes
+3744 | Urticales | | includes
+3745 | Malaceae | | synonym
+3745 | Malaceae Sm., 1903 | | authority
+3745 | Rosaceae | | scientific name
+3745 | Rosaceae Juss., 1789 | | authority
+3745 | rose family | | common name
+3764 | Rosa | | scientific name
+3764 | Rosa L., 1753 | | authority
+3803 | Fabaceae | | scientific name
+3803 | Fabaceae Lindl., 1836 | | authority
+3803 | Leguminosae | | synonym
+3803 | pea family | | common name
+3814 | Faboideae | | synonym
+3814 | Faboideae Rudd, 1968 | | authority
+3814 | Papilionoideae | | scientific name
+3841 | Erythrina | | scientific name
+3841 | Erythrina L. | | authority
+4011 | Anacardiaceae | | scientific name
+4011 | Anacardiaceae R.Br., 1818 | | authority
+4011 | sumac family | | common name
+4036 | Apiales | | scientific name
+4036 | Apiales Nakai, 1930 | | authority
+4036 | Araliales | | synonym
+4036 | Araliales Juss. ex Bercht. & J.Presl, 1820 | | authority
+4037 | Apiaceae | | scientific name
+4037 | Apiaceae Lindl., 1836 | | authority
+4037 | Umbelliferae | | synonym
+4037 | carrot family | | common name
+4055 | Gentianales | | scientific name
+4055 | Gentianales Juss. ex Bercht. & J.Presl, 1820 | | authority
+4143 | Lamiales | | scientific name
+4143 | Lamiales Bromhead, 1838 | | authority
+4143 | Scrophulariales | | includes
+4149 | Buddlejaceae | | includes
+4149 | Buddlejaceae K.Wilh., 1910 | | authority
+4149 | Myoporaceae | | includes
+4149 | Myoporaceae R.Br., 1810 | | authority
+4149 | Scrophulariaceae | Scrophulariaceae | scientific name
+4149 | Scrophulariaceae Juss., 1789 | | authority
+4149 | Selaginaceae | | includes
+4149 | Selaginaceae Choisy, 1823 | | authority
+4149 | figwort family | | common name
+4199 | Dipsacales | | scientific name
+4199 | Dipsacales Juss. ex Bercht. & J.Presl, 1820 | | authority
+4200 | Caprifoliaceae | | scientific name
+4200 | Caprifoliaceae Juss., 1789 | | authority
+4200 | honeysuckle famly | | common name
+4209 | Asterales | | scientific name
+4209 | Asterales Link, 1829 | | authority
+4209 | Campanulales | | includes
+4210 | Asteraceae | | scientific name
+4210 | Asteraceae Bercht. & J.Presl, 1820 | | authority
+4210 | Compositae | | equivalent name
+4210 | daisy family | | common name
+4231 | Helianthus | | scientific name
+4231 | Helianthus L., 1753 | | authority
+4231 | sunflowers | | common name
+4321 | Icacinaceae | Icacinaceae | scientific name
+4321 | Icacinaceae Miers, 1851 | | authority
+4447 | Liliopsida | | scientific name
+4447 | Monocotyledoneae | | synonym
+4447 | monocots | monocots | blast name
+4447 | monocots | monocots | genbank common name
+4447 | monocotyledons | | common name
+4454 | Araceae | | scientific name
+4454 | Araceae Juss., 1789 | | authority
+4454 | Lemnaceae | | includes
+4454 | arum family | | common name
+4479 | Bambusaceae | | synonym
+4479 | Bambusaceae Nakai, 1943 | | authority
+4479 | Gramineae | | synonym
+4479 | Poaceae | | scientific name
+4479 | Poaceae Barnhart, 1895 | | authority
+4479 | grass family | | common name
+4496 | Avena | | scientific name
+4496 | Avena L., 1753 | | authority
+4500 | Avena longiglumis | | scientific name
+4500 | Avena longiglumis Durieu, 1845 | | authority
+4523 | Neurachne | | scientific name
+4523 | Neurachne R.Br. | | authority
+4581 | Bambusa | | scientific name
+4581 | Bambusa Schreb. | | authority
+4581 | bamboos | | genbank common name
+4667 | Liliales | | scientific name
+4667 | Liliales Perleb, 1826 | | authority
+4667 | Liliales/Asparagales group | Liliales/Asparagales group | in-part
+4667 | Liliiflorae | Liliiflorae | in-part
+4667 | Orchidales | | includes
+4734 | Commelinidae | | synonym
+4734 | Commeliniflorae | | synonym
+4734 | commelinids | | scientific name
+4747 | Orchidaceae | | scientific name
+4747 | Orchidaceae Juss., 1789 | | authority
+4747 | orchid family | | common name
+4751 | Fungi | | scientific name
+4751 | Mycota | | synonym
+4751 | fungi | | blast name
+4762 | Oomycetes | | synonym
+4762 | Oomycetes G. Winter, 1880 | | authority
+4762 | Oomycota | | scientific name
+4762 | Oomycota Arx, 1967 | | authority
+4762 | oomycetes | | blast name
+4763 | Saprolegniales | | scientific name
+4763 | Saprolegniales Prantl, 1874 | | authority
+4764 | Saprolegniaceae | | scientific name
+4769 | Saprolegnia | | scientific name
+4890 | Ascomycota | | scientific name
+4890 | ascomycete fungi | ascomycete fungi | blast name
+4890 | ascomycete fungi | ascomycete fungi | genbank common name
+4890 | sac fungi | | common name
+4958 | Debaryomyces | | scientific name
+4958 | Debaryomyces Lodder & Kreger-van Rij ex Kreger-van Rij, 1984 | | authority
+4958 | Wingea | | synonym
+4972 | ATCC 24291 | ATCC 24291 | type material
+4972 | Bullera armeniaca | | synonym
+4972 | CBS 4214 | CBS 4214 | type material
+4972 | CCRC 21600 | CCRC 21600 | type material
+4972 | CCRC:21600 | CCRC:21600 | type material
+4972 | Cryptococcus hungaricus | | synonym
+4972 | Cryptococcus sp. GU67 | | includes
+4972 | DBVPG 7152 | DBVPG 7152 | type material
+4972 | Dioszegia hungarica | | scientific name
+4972 | Dioszegia hungarica Zsolt, 1957 | | authority
+4972 | IFO 1052 | IFO 1052 | type material
+4972 | IGC 3954 | IGC 3954 | type material
+4972 | JCM 9046 | JCM 9046 | type material
+4972 | MUCL 30660 | MUCL 30660 | type material
+4972 | NRRL Y-6667 | NRRL Y-6667 | type material
+4972 | UCD 68-187 | UCD 68-187 | type material
+4972 | specimen-voucher:NRRL:Y:6667 | specimen-voucher:NRRL:Y:6667 | type material
+5036 | Histoplasma | | scientific name
+5036 | Histoplasma Darling, 1906 | | authority
+5037 | ATCC 22635 [[Emmonsiella capsulata]] | ATCC 22635 [[Emmonsiella capsulata]] | type material
+5037 | Ajellomyces capsulatus (Kwon-Chung) McGinnis & Katz, 1979 | | synonym
+5037 | CBS 136.72 [[Emmonsiella capsulata]] | CBS 136.72 [[Emmonsiella capsulata]] | type material
+5037 | Cryptococcus capsulatus | | synonym
+5037 | Cryptococcus capsulatus (Darling) Castell. & Chalm., 1919 | | authority
+5037 | Emmonsiella capsulata | | synonym
+5037 | Emmonsiella capsulata Kwon-Chung, 1972 | | authority
+5037 | Histoplasma capsulatum | | scientific name
+5037 | Histoplasma capsulatum Darling, 1906 | | authority
+5039 | ATCC 18188 | ATCC 18188 | type material
+5039 | Ajellomyces dermatitidis | | synonym
+5039 | Ajellomyces dermatitidis McDonough & A.L. Lewis, 1968 | | authority
+5039 | Blastomyces dermatitidis | | scientific name
+5039 | Blastomyces dermatitidis Gilchrist & W.R. Stokes, 1898 | | authority
+5039 | Blastomycoides dermatitidis | | synonym
+5039 | CBS 674.68 | CBS 674.68 | type material
+5039 | UAMH 3539 | UAMH 3539 | type material
+5039 | UAMH-3539 | UAMH-3539 | type material
+5039 | UAMH3539 | UAMH3539 | type material
+5039 | UAMH:3539 | UAMH:3539 | type material
+5125 | Hypocreales | | scientific name
+5125 | Hypocreales Lindau, 1897 | | authority
+5125 | Pyrenomycetes | Pyrenomycetes | in-part
+5139 | Sordariales | | scientific name
+5139 | Sordariales Chadef. ex D. Hawksw. & O.E. Erikss., 1986 | | authority
+5149 | Chaetomium | | scientific name
+5149 | Chaetomium Kunze, 1817 | | authority
+5197 | Lecanorales | | scientific name
+5197 | Lecanorales Nannf., 1932 | | authority
+5198 | Cladiaceae | | includes
+5198 | Cladoniaceae | | scientific name
+5198 | Cladoniaceae Zenker, 1827 | | authority
+5199 | Cladina | | includes
+5199 | Cladina (Nyl.) Nyl., 1866 | | authority
+5199 | Cladonia | | scientific name
+5204 | Basidiomycota | | scientific name
+5204 | basidiomycete fungi | basidiomycete fungi | blast name
+5204 | basidiomycete fungi | basidiomycete fungi | genbank common name
+5204 | basidiomycetes | | common name
+5234 | Christianseniales | | includes
+5234 | Tremellales | | scientific name
+5234 | Tremellales Fr., 1821 | | authority
+5234 | anamorphic Tremellales | | includes
+5234 | jelly fungi | | genbank common name
+5234 | mitosporic Tremellales | | includes
+5302 | Agaricomycotina | | scientific name
+5302 | Agaricomycotina Doweld, 2001 | | authority
+5302 | Hymenomycetes | | equivalent name
+5303 | Aphyllophorales | | synonym
+5303 | Polyporales | | scientific name
+5303 | Polyporales Gaum., 1926 | | authority
+5303 | anamorphic Aphyllophorales | | includes
+5303 | anamorphic Polyporales | | includes
+5303 | mitosporic Aphyllophorales | | includes
+5303 | mitosporic Polyporales | | includes
+5305 | Phanerochaete | | scientific name
+5305 | Phanerochaete P. Karst., 1889 | | authority
+5314 | Ganoderma | | scientific name
+5314 | Ganoderma P. Karst., 1881 | | authority
+5314 | Magoderna | | synonym
+5314 | Magoderna Steyaert, 1972 | | authority
+5317 | Coriolaceae | | synonym
+5317 | Cryptoporaceae | | synonym
+5317 | Echinochaetaceae | | synonym
+5317 | Fomitaceae | | synonym
+5317 | Ganodermataceae | | synonym
+5317 | Grammotheleaceae | | synonym
+5317 | Haddowiaceae | | synonym
+5317 | Lentinaceae | | synonym
+5317 | Lentinaceae Julich | | synonym
+5317 | Lophariaceae | | synonym
+5317 | Microporaceae | | synonym
+5317 | Pachykytosporaceae | | synonym
+5317 | Perenniporiaceae | | synonym
+5317 | Polyporaceae | | scientific name
+5317 | Sparsitubaceae | | synonym
+5317 | Trametaceae | | synonym
+5317 | bracket fungi | | genbank common name
+5338 | Agaricales | | scientific name
+5338 | Agaricales Underw., 1899 | | authority
+5338 | Agaricales anamorphs | | synonym
+5338 | Hymenogastrales | | synonym
+5338 | Lycoperdales | | synonym
+5338 | Nidulariales | | synonym
+5338 | Tulostomatales | | synonym
+5338 | anamorphic Agaricales | | synonym
+5338 | gasteromycetes | gasteromycetes | includes
+5338 | gill mushrooms | | genbank common name
+5338 | mitosporic Agaricales | | includes
+5455 | Colletotrichum | | scientific name
+5455 | Colletotrichum Corda, 1831 | | authority
+5455 | Glomerella | Glomerella | synonym
+5455 | Glomerella Spauld. & H. Schrenk 1903 | | authority
+5500 | Coccidioides | | scientific name
+5500 | Coccidioides C.W. Stiles, 1896 | | authority
+5501 | CBS 120936 | CBS 120936 | type material
+5501 | CBS 144.34 | CBS 144.34 | type material
+5501 | CBS H-19842 | CBS H-19842 | type material
+5501 | Coccidioides immitis | | scientific name
+5501 | Coccidioides immitis G.W. Stiles, 1896 | | authority
+5501 | RMSCC 2394 | RMSCC 2394 | type material
+5506 | Albonectria | | synonym
+5506 | Albonectria Rossman & Samuels, 1999 | | authority
+5506 | Bisifusarium | | synonym
+5506 | Bisifusarium L. Lombard, Crous & W. Gams, 2015 | | authority
+5506 | Cyanonectria | | synonym
+5506 | Cyanonectria Samuels & P. Chaverri, 2009 | | authority
+5506 | Fusarium | | scientific name
+5506 | Fusarium Link, 1809 | | authority
+5506 | Fusarium sect. Setofusarium | | synonym
+5506 | Fusarium sect. Setofusarium Nirenberg & Samuels, 1989 | | authority
+5506 | Fusisporium | | synonym
+5506 | Fusisporium Link, 1809 | | authority
+5506 | Geejayessia | | synonym
+5506 | Geejayessia Schroers, Grafenhan & Seifert, 2011 | | authority
+5506 | Gibberella | | synonym
+5506 | Gibberella Sacc., 1877 | | authority
+5506 | Haematonectria | | synonym
+5506 | Haematonectria Samuels & Nirenberg, 1999 | | authority
+5506 | Luteonectria | | synonym
+5506 | Luteonectria Sand.-Den., L. Lombard, Schroers & Rossman, 2021 | | synonym
+5506 | Neocosmospora | | synonym
+5506 | Neocosmospora E.F. Sm., 1899 | | authority
+5506 | Nothofusarium | | synonym
+5506 | Nothofusarium Crous, Sand.-Den. & L. Lombard, 2021 | | authority
+5506 | Rectifusarium | | synonym
+5506 | Rectifusarium L. Lombard, Crous & W. Gams, 2015 | | authority
+5506 | Setofusarium | | synonym
+5506 | Setofusarium (Nirenberg & Samuels) Crous & Sand.-Den., 2021 | | authority
+5550 | Bodinia | | synonym
+5550 | Bodinia M. Ota & Langeron, 1923 | | authority
+5550 | Grubyella | | synonym
+5550 | Grubyella M. Ota & Langeron, 1923 | | authority
+5550 | Trichophyton | | scientific name
+5550 | Trichophyton Malmsten, 1848 | | authority
+5551 | ATCC 32871 [[Trichophyton fischeri]] | ATCC 32871 [[Trichophyton fischeri]] | type material
+5551 | ATCC 42631 [[Trichophyton raubitschekii]] | ATCC 42631 [[Trichophyton raubitschekii]] | type material
+5551 | ATCC 62345 [[Trichophyton kanei]] | ATCC 62345 [[Trichophyton kanei]] | type material
+5551 | CBS 100081 [[Trichophyton fischeri]] | CBS 100081 [[Trichophyton fischeri]] | type material
+5551 | CBS 100084 [[Trichophyton raubitschekii]] | CBS 100084 [[Trichophyton raubitschekii]] | type material
+5551 | CBS 289.86 [[Trichophyton kanei]] | CBS 289.86 [[Trichophyton kanei]] | type material
+5551 | CBS 392.58 | CBS 392.58 | type material
+5551 | Epidermophyton rubrum | | synonym
+5551 | Epidermophyton rubrum Castell., 1910 | | authority
+5551 | IMI 213848 [[Trichophyton fischeri]] | IMI 213848 [[Trichophyton fischeri]] | type material
+5551 | Microsporum rubrum | | synonym
+5551 | Microsporum rubrum Cazalbou, 1913 | | authority
+5551 | Sabouraudites ruber | | synonym
+5551 | Sabouraudites ruber (Cazalbou) Nann., 1934 | | synonym
+5551 | TRTC 50887 [[Trichophyton kanei]] | TRTC 50887 [[Trichophyton kanei]] | type material
+5551 | Trichophyton fischeri | | synonym
+5551 | Trichophyton fischeri J. Kane, 1977 | | authority
+5551 | Trichophyton kanei | | synonym
+5551 | Trichophyton kanei Summerb., 1987 | | authority
+5551 | Trichophyton megninii | | synonym
+5551 | Trichophyton megninii R. Blanch., 1895 | | authority
+5551 | Trichophyton raubitschekii | | synonym
+5551 | Trichophyton raubitschekii J. Kane, Salkin, Weitzman & Smitka, 1981 | | authority
+5551 | Trichophyton rubrum | | scientific name
+5551 | Trichophyton rubrum (Castell.) Sabour., 1911 | | authority
+5551 | Trichophyton rubrum var. raubitschekii | | synonym
+5794 | Apicomplexa | | scientific name
+5794 | Apicomplexa Levine 1980, emend. Adl et al. 2005 | | authority
+5794 | apicomplexans | apicomplexans | blast name
+5794 | apicomplexans | apicomplexans | genbank common name
+5796 | Coccidia | | scientific name
+5796 | coccidians | | synonym
+5809 | Sarcocystidae | | scientific name
+5809 | Sarcocystids | | synonym
+5819 | Haemosporida | | scientific name
+5819 | Haemosporina | | synonym
+5819 | Haemospororida | | synonym
+5819 | haemosporidians | | genbank common name
+5820 | Plasmodium | Plasmodium | scientific name
+5820 | Saurocytozoon | | synonym
+5825 | Plasmodium chabaudi | | scientific name
+5857 | Plasmodium fragile | | scientific name
+5860 | Plasmodium vinckei | | scientific name
+5860 | Plasmodium vinckei (Rodhain, 1952) | | authority
+5863 | Piroplasmida | | scientific name
+5863 | Piroplasmids | | genbank common name
+5872 | Babesia equi | | synonym
+5872 | Babesia equi Laveran, 1901 | | authority
+5872 | Theileria equi | | scientific name
+5872 | Theileria equi (Laveran, 1901) Mehlhorn & Schein 1998 | | authority
+5873 | Theileria | | scientific name
+5873 | Theileria Bettencourt et al. 1907 | | authority
+5874 | Theileria annulata | | scientific name
+6072 | Eumetazoa | | scientific name
+6073 | Cnidaria | | scientific name
+6073 | Coelenterata | Coelenterata | in-part
+6073 | cnidarians | cnidarians | blast name
+6073 | cnidarians | cnidarians | genbank common name
+6073 | coelenterates | coelenterates | common name
+6101 | Anthozoa | | scientific name
+6101 | anthozoans | anthozoans | blast name
+6101 | anthozoans | anthozoans | genbank common name
+6102 | Ceriantipatharia | | includes
+6102 | Hexacorallia | | scientific name
+6125 | Madreporaria | | synonym
+6125 | Scleractinia | | scientific name
+6125 | stony corals | stony corals | blast name
+6125 | stony corals | stony corals | genbank common name
+6126 | Acroporidae | | scientific name
+6127 | Acropora | | scientific name
+6127 | staghorn corals | | genbank common name
+6157 | Neorhabdocoela | | includes
+6157 | Platyhelminthes | | scientific name
+6157 | Proplicastomata | | includes
+6157 | Turbellaria | | includes
+6157 | Turbellarian Platyhelminths | | includes
+6157 | flatworm | | common name
+6157 | flatworms | flatworms | blast name
+6157 | flatworms | flatworms | genbank common name
+6159 | Tricladida | | scientific name
+6199 | Cestoda | | scientific name
+6199 | tapeworms | | genbank common name
+6200 | Eucestoda | | scientific name
+6217 | Nemertea | | scientific name
+6217 | Nemertini | | synonym
+6217 | bootlace worms | | common name
+6217 | nemertines | | common name
+6217 | ribbon worms | ribbon worms | blast name
+6217 | ribbon worms | ribbon worms | genbank common name
+6218 | Anopla | | synonym
+6218 | Pilidiophora | | scientific name
+6219 | Heteronemertea | | scientific name
+6219 | Heteronemertini | | synonym
+6219 | heteronemertine worms | | genbank common name
+6222 | Cerebratulidae | | synonym
+6222 | Lineidae | | scientific name
+6231 | Nemata | | synonym
+6231 | Nematoda | | scientific name
+6231 | nematode | | common name
+6231 | nematodes | nematodes | blast name
+6231 | nematodes | nematodes | genbank common name
+6231 | roundworm | | common name
+6231 | roundworms | | common name
+6236 | Rhabditida | | scientific name
+6236 | Strongylida | | synonym
+6249 | Ascaridida | | synonym
+6249 | Ascaridomorpha | | scientific name
+6267 | Anisakidae | | scientific name
+6274 | Spirurida | | synonym
+6274 | Spirurina | | scientific name
+6447 | Mollusca | | scientific name
+6447 | molluscs | molluscs | blast name
+6447 | molluscs | molluscs | genbank common name
+6447 | mollusks | | common name
+6544 | Bivalvia | | scientific name
+6544 | Lamellibranchiata | | synonym
+6544 | Pelecypoda | | synonym
+6544 | bivalves | bivalves | blast name
+6544 | bivalves | bivalves | genbank common name
+6599 | Heteroconchia | | scientific name
+6656 | Arthropoda | | scientific name
+6656 | arthropods | arthropods | blast name
+6656 | arthropods | arthropods | genbank common name
+6657 | Crustacea | | scientific name
+6657 | crustaceans | crustaceans | blast name
+6657 | crustaceans | crustaceans | genbank common name
+6681 | Malacostraca | | scientific name
+6682 | Eucarida | | scientific name
+6683 | Decapoda | | scientific name
+6692 | Pleocyemata | | scientific name
+6712 | Astacidea | | scientific name
+6712 | Astacura | | synonym
+6712 | true lobsters and crayfishes | | genbank common name
+6738 | Anomura | | scientific name
+6738 | hermit crabs | hermit crabs | genbank common name
+6744 | Coenobitoidea | | includes
+6744 | Paguroidea | | scientific name
+6745 | Paguridae | | scientific name
+6746 | Pagurus | | scientific name
+6746 | hermit crabs | hermit crabs | common name
+6752 | Brachyura | | scientific name
+6752 | short-tailed crabs | | genbank common name
+6752 | true crabs | | common name
+6960 | Atelocerata | Atelocerata | in-part
+6960 | Hexapoda | | scientific name
+6960 | Tracheata | Tracheata | in-part
+6960 | Uniramia | Uniramia | in-part
+6960 | hexapods | hexapods | blast name
+6960 | hexapods | hexapods | genbank common name
+6961 | Odonata | | scientific name
+6961 | dragonflies & damselflies | dragonflies & damselflies | blast name
+6961 | dragonflies & damselflies | dragonflies & damselflies | genbank common name
+6970 | Dictyoptera | Dictyoptera | scientific name
+6993 | Orthoptera | | scientific name
+6993 | Saltatoria | | synonym
+6993 | grasshoppers, crickets & katydids | grasshoppers, crickets & katydids | blast name
+6993 | grasshoppers, crickets & katydids | grasshoppers, crickets & katydids | genbank common name
+6994 | Ensifera | Ensifera | scientific name
+6994 | crickets & katydids | | genbank common name
+7041 | Coleoptera | | scientific name
+7041 | beetles | beetles | blast name
+7041 | beetles | beetles | genbank common name
+7042 | Curculionidae | | scientific name
+7042 | weevils | | genbank common name
+7088 | Lepidoptera | | scientific name
+7088 | moths & butterflies | moths & butterflies | blast name
+7088 | moths & butterflies | moths & butterflies | genbank common name
+7089 | Bombycidae | | scientific name
+7089 | silkworm moths | | genbank common name
+7100 | Noctuidae | | scientific name
+7100 | noctuid moths | | common name
+7100 | owlet moths | | genbank common name
+7147 | Diptera | | scientific name
+7147 | flies | flies | blast name
+7147 | flies | flies | genbank common name
+7148 | Nematocera | | scientific name
+7157 | Culicidae | | scientific name
+7157 | mosquitos | mosquitos | blast name
+7157 | mosquitos | mosquitos | genbank common name
+7158 | Aedes | Aedes | scientific name
+7399 | Hymenoptera | | scientific name
+7399 | hymenopterans | hymenopterans | blast name
+7399 | hymenopterans | hymenopterans | genbank common name
+7400 | Apocrita | | scientific name
+7400 | wasps, ants & bees | wasps, ants & bees | blast name
+7400 | wasps, ants & bees | wasps, ants & bees | common name
+7401 | Ichneumonoidea | | scientific name
+7402 | Braconidae | | scientific name
+7434 | Aculeata | Aculeata | scientific name
+7434 | Aculeata Latreille, 1802 | | authority
+7458 | Apidae | | scientific name
+7458 | bumble bees and honey bees | | genbank common name
+7459 | Apis | | scientific name
+7496 | Pterygota | Pterygota | scientific name
+7496 | winged insects | | genbank common name
+7516 | Neuroptera | | scientific name
+7516 | Planipennia | | synonym
+7516 | lacewings | | common name
+7516 | net-winged insects | | genbank common name
+7524 | Hemiptera | | scientific name
+7524 | Homoptera | | includes
+7524 | true bugs | true bugs | blast name
+7524 | true bugs | true bugs | genbank common name
+7581 | Comatulida | | scientific name
+7586 | Echinodermata | | scientific name
+7586 | echinoderms | echinoderms | blast name
+7586 | echinoderms | echinoderms | genbank common name
+7711 | Chordata | | scientific name
+7711 | chordates | chordates | blast name
+7711 | chordates | chordates | genbank common name
+7742 | Vertebrata | Vertebrata | scientific name
+7742 | Vertebrata Cuvier, 1812 | | authority
+7742 | vertebrates | vertebrates | blast name
+7742 | vertebrates | vertebrates | genbank common name
+7776 | Gnathostomata | Gnathostomata | scientific name
+7776 | jawed vertebrates | | genbank common name
+7777 | Chondrichthyes | | scientific name
+7777 | cartilaginous fishes | cartilaginous fishes | blast name
+7777 | cartilaginous fishes | cartilaginous fishes | genbank common name
+7777 | fish | fish | common name
+7777 | fishes | fishes | common name
+7778 | Elasmobranchii | | scientific name
+7778 | elasmobranchs | | common name
+7778 | sharks & rays | sharks & rays | blast name
+7778 | sharks & rays | sharks & rays | genbank common name
+7898 | Actinopterygi | | synonym
+7898 | Actinopterygii | | scientific name
+7898 | Osteichthyes | Osteichthyes | in-part
+7898 | fish | fish | common name
+7898 | fishes | fishes | common name
+7898 | ray-finned fishes | ray-finned fishes | blast name
+7898 | ray-finned fishes | ray-finned fishes | genbank common name
+7952 | Cypriniformes | | scientific name
+7952 | carps and others | | genbank common name
+7953 | Cyprinidae | | scientific name
+7982 | Cobitidae | | scientific name
+7982 | loaches | | genbank common name
+7983 | Misgurnus | | scientific name
+8006 | Salmoniformes | | scientific name
+8006 | salmons and trouts | | genbank common name
+8015 | Salmonidae | | scientific name
+8015 | salmonids | | genbank common name
+8033 | Salvelinus | | scientific name
+8034 | NHMW:91214 | NHMW:91214 | type material
+8034 | NMW:91214 | NMW:91214 | type material
+8034 | NMW:91214 | NMW:91214 | type material
+8034 | Salmo leucomaenis | | synonym
+8034 | Salmo leucomaenis Pallas, 1814 | | authority
+8034 | Salvelinus leucomaenis | | scientific name
+8034 | Salvelinus leucomaenis (Pallas, 1814) | | authority
+8034 | ZMB:23552 | ZMB:23552 | type material
+8034 | ZMB:23563 | ZMB:23563 | type material
+8034 | amemasu char | | common name
+8034 | whitespotted char | | genbank common name
+8035 | Salmo pluvius | | synonym
+8035 | Salmo pluvius Hilgendorf, 1876 | | authority
+8035 | Salvelinus leucomaenis pluvius | | scientific name
+8035 | Salvelinus pluvius | | synonym
+8111 | Perciformes | | scientific name
+8111 | Scorpaeniformes | | synonym
+8111 | Serraniformes | | synonym
+8111 | perches and others | | genbank common name
+8113 | Cichlidae | | scientific name
+8113 | cichlids | | genbank common name
+8205 | Notothenioidei | | scientific name
+8219 | Gobioidei | | scientific name
+8220 | Gobiidae | | scientific name
+8220 | Microdesmidae | | synonym
+8220 | Trypauchenidae | | synonym
+8220 | burrowing gobies | | common name
+8220 | gobies | | genbank common name
+8220 | wormfishes | | common name
+8252 | Pleuronectiformes | | scientific name
+8252 | flatfishes | | genbank common name
+8256 | Pleuronectidae | | scientific name
+8256 | righteye flounders | | genbank common name
+8287 | Sarcopterygii | | scientific name
+8292 | Amphibia | | scientific name
+8292 | Lissamphibia | | includes
+8292 | amphibians | amphibians | blast name
+8292 | amphibians | amphibians | genbank common name
+8293 | Caudata | | scientific name
+8293 | Urodela | | synonym
+8293 | salamanders | salamanders | blast name
+8293 | salamanders | salamanders | genbank common name
+8294 | Ambystomatidae | | scientific name
+8294 | mole salamanders | mole salamanders | genbank common name
+8295 | Ambystoma | | scientific name
+8295 | big salamanders | | common name
+8295 | mole salamanders | mole salamanders | genbank common name
+8306 | Ambystoma talpoideum | | scientific name
+8306 | Ambystoma talpoideum (Holbrook, 1838) | | authority
+8306 | Salamandra talpoidea | | synonym
+8306 | Salamandra talpoidea Holbrook, 1838 | | authority
+8306 | mole salamander | | genbank common name
+8342 | Anura | | scientific name
+8342 | Salientia | | synonym
+8342 | anurans | | common name
+8342 | frogs | | common name
+8342 | frogs & toads | frogs & toads | blast name
+8342 | frogs & toads | frogs & toads | genbank common name
+8416 | Neobatrachia | | scientific name
+8426 | Microhyloidea | | scientific name
+8427 | Microhylidae | | scientific name
+8427 | microhylid toads | | genbank common name
+8457 | Sauropsida | | scientific name
+8457 | sauropsids | | genbank common name
+8492 | Archosauria | | scientific name
+8782 | Aves | | scientific name
+8782 | avian | | synonym
+8782 | birds | birds | blast name
+8782 | birds | birds | genbank common name
+8825 | Neognathae | | scientific name
+8826 | Anseriformes | | scientific name
+8826 | ducks, geese & swans | | genbank common name
+8827 | Anhimidae | | scientific name
+8827 | screamers | | genbank common name
+8828 | Chauna | | scientific name
+8906 | Charadriiformes | | scientific name
+8906 | Turniciformes | | includes
+8906 | shorebirds & allies | | genbank common name
+8906 | shorebirds and others | | common name
+8936 | Coraciadiformes | | synonym
+8936 | Coraciiformes | | scientific name
+8936 | kingfishers and others | | genbank common name
+8940 | Cuculiformes | | scientific name
+8940 | cuckoos and others | | genbank common name
+8941 | Cuculidae | | scientific name
+8941 | cuckoos | | genbank common name
+8948 | Falconiformes | | scientific name
+8948 | falcons and others | | genbank common name
+8949 | Falconidae | | scientific name
+8955 | Accipitrinae | | scientific name
+9108 | Gruiformes | | scientific name
+9108 | cranes, rails & allies | | genbank common name
+9108 | terrestrial and marshbirds | | common name
+9126 | Passeriformes | | scientific name
+9126 | song birds | | genbank common name
+9219 | Galbuliformes | | includes
+9219 | Piciformes | | scientific name
+9219 | jacamars | | common name
+9219 | woodpeckers and others | | genbank common name
+9223 | Psittaciformes | | scientific name
+9223 | parrots and others | | genbank common name
+9224 | Psittacidae | | scientific name
+9224 | parrot | | common name
+9224 | parrots | | genbank common name
+9230 | Sphenisciformes | | scientific name
+9230 | penguins | penguins | genbank common name
+9231 | Spheniscidae | | scientific name
+9231 | penguins | penguins | genbank common name
+9239 | Spheniscus | | scientific name
+9263 | Marsupialia | | synonym
+9263 | Metatheria | | scientific name
+9263 | marsupials | marsupials | blast name
+9263 | marsupials | marsupials | genbank common name
+9265 | American opossums | | common name
+9265 | Didelphidae | | scientific name
+9265 | opossums | | genbank common name
+9266 | Didelphis | | scientific name
+9347 | Eutheria | | scientific name
+9347 | Placentalia | | synonym
+9347 | eutherian mammals | | common name
+9347 | placental mammals | | common name
+9347 | placentals | placentals | blast name
+9347 | placentals | placentals | genbank common name
+9397 | Chiroptera | | scientific name
+9397 | bats | bats | blast name
+9397 | bats | bats | genbank common name
+9431 | Vespertilionidae | | scientific name
+9431 | common bats | | common name
+9431 | vesper bats | | genbank common name
+9431 | vespertilionid bats | | common name
+9434 | Myotis | | scientific name
+9655 | Mustelidae | | scientific name
+9655 | weasel, mink, badger, martens and others | | genbank common name
+9671 | Pteronura | | scientific name
+9672 | Pteronura brasiliensis | | scientific name
+9672 | Pteronura brasiliensis Zimmermann, 1780 | | authority
+9672 | giant otter | | genbank common name
+9681 | Felidae | | scientific name
+9681 | cat family | | genbank common name
+9688 | Leo | | synonym
+9688 | Panthera | | scientific name
+9688 | Uncia | | synonym
+9690 | Panthera onca | | scientific name
+9690 | jaguar | | genbank common name
+9845 | Ruminantia | | scientific name
+9895 | Bovidae | | scientific name
+9918 | Bubalus | | scientific name
+9975 | Lagomorpha | | scientific name
+9975 | Lagomorpha Brandt, 1855 | | authority
+9975 | rabbits & hares | | blast name
+9979 | Leporidae | | scientific name
+9979 | Leporidae Fischer, 1817 | | authority
+9979 | rabbits and hares | | genbank common name
+9980 | Lepus | | scientific name
+9980 | Lepus Linnaeus, 1758 | | authority
+9980 | hares | | genbank common name
+9989 | Rodentia | | scientific name
+9989 | rodent | | common name
+9989 | rodents | rodents | blast name
+9989 | rodents | rodents | genbank common name
+10045 | Gerbillinae | | scientific name
+10045 | gerbils | | genbank common name
+10066 | Muridae | | scientific name
+10239 | Vira | | synonym
+10239 | Viridae | | synonym
+10239 | Viruses | | scientific name
+10239 | viruses | | blast name
+10293 | Alphaherpesvirinae | | scientific name
+10293 | Alphaherpesviruses | | common name
+10294 | Simplexvirus | | scientific name
+10319 | Varicellovirus | | scientific name
+10357 | Betaherpesvirinae | | scientific name
+10357 | Betaherpesviruses | | common name
+10358 | Cytomegalovirus | | scientific name
+10374 | Gammaherpesvirinae | | scientific name
+10374 | Gammaherpesviruses | | common name
+10374 | lymphoproliferative virus group | | genbank common name
+10404 | Hepadnaviridae | | scientific name
+10404 | hepatitis B-type viruses | | genbank common name
+10405 | Orthohepadnavirus | | scientific name
+10405 | mammalian hepatitis B-type viruses | | genbank common name
+10442 | Baculoviridae | | scientific name
+10566 | Human Papilloma Virus | | equivalent name
+10566 | Human papillomavirus | | scientific name
+10566 | human papillomavirus HPV | | equivalent name
+10567 | Iotapapillomavirus 1 | | scientific name
+10567 | Mastomys natalensis papillomavirus | | equivalent name
+10567 | Multimammate rat papillomavirus | | equivalent name
+10567 | Praomys natalensis papillomavirus | | equivalent name
+10639 | Caulimovirus | | scientific name
+10652 | Badnavirus | | scientific name
+10652 | Commelina yellow mottle virus group | | equivalent name
+10780 | Parvoviridae | | scientific name
+10803 | Dependoparvovirus | | scientific name
+10803 | Dependovirus | | equivalent name
+10803 | dependoviruses | | common name
+10811 | Geminiviridae | | scientific name
+10811 | Geminivirus | | equivalent name
+10812 | Geminivirus subgroup I | | equivalent name
+10812 | Mastrevirus | | scientific name
+10812 | Subgroup I Geminivirus | | equivalent name
+10814 | Begomovirus | | scientific name
+10814 | Geminivirus subgroup III | | equivalent name
+10814 | Subgroup III Geminivirus | | equivalent name
+10841 | Microviridae | | scientific name
+10841 | bacterial virus | bacterial virus | in-part
+10841 | bacterial viruses | bacterial viruses | in-part
+10841 | isometric ssDNA phages | | genbank common name
+10841 | prokaryotic virus | prokaryotic virus | in-part
+10882 | Orthoreovirus | | scientific name
+10882 | RAM-1 | | acronym
+10882 | Reoviruses | | equivalent name
+10892 | Orbiviridae | | equivalent name
+10892 | Orbivirus | | scientific name
+10892 | Orbiviruses | | equivalent name
+10979 | Aquareovirus | | scientific name
+10988 | Fijivirus | | scientific name
+10988 | plant reovirus 2 | | genbank common name
+10989 | MRDV | | acronym
+10989 | Maize rough dwarf fijivirus | | equivalent name
+10989 | Maize rough dwarf virus | | scientific name
+10993 | Birnaviridae | | scientific name
+11006 | Totiviridae | | scientific name
+11006 | monopartite dsRNA genome mycoviruses | | genbank common name
+11007 | Totivirus | | scientific name
+11012 | Partitiviridae | | scientific name
+11050 | Flaviviridae | | scientific name
+11050 | Flavivirus (arbovirus group B) | | equivalent name
+11095 | Pestivirus | | scientific name
+11102 | Hepacivirus | | scientific name
+11102 | Hepatitis C virus group | | equivalent name
+11102 | Hepatitis C viruses | | equivalent name
+11102 | Hepatitis C-like viruses | | equivalent name
+11118 | Coronaviridae | | scientific name
+11157 | Mononegavirales | | scientific name
+11157 | negative-sense genome single-stranded RNA viruses | | genbank common name
+11158 | Paramyxoviridae | | scientific name
+11229 | Morbillivirus | | scientific name
+11229 | Morbilliviruses | | equivalent name
+11240 | Phocine distemper virus | | equivalent name
+11240 | Phocine morbillivirus | | scientific name
+11240 | phocid distemper virus | | equivalent name
+11240 | phocid distemper virus PDV | | equivalent name
+11240 | phocine distemper virus PDV | | equivalent name
+11270 | Rhabdoviridae | | scientific name
+11271 | Vesiculovirus | | scientific name
+11308 | Orthomyxoviridae | | scientific name
+11318 | Dhori thogotovirus | | equivalent name
+11318 | Dhori virus | | equivalent name
+11318 | Thogotovirus dhoriense | | scientific name
+11318 | Tick-borne virus | | equivalent name
+11319 | Dhori virus (strain Indian/1313/61) | | scientific name
+11572 | Bunyavirus | | equivalent name
+11572 | Bunyaviruses | | equivalent name
+11572 | Orthobunyavirus | | scientific name
+11582 | Aino virus | | scientific name
+11584 | Phlebovirus | | scientific name
+11584 | Phleboviruses | | equivalent name
+11617 | Arenaviridae | | scientific name
+11632 | Retroviridae | | scientific name
+11974 | Caliciviridae | | scientific name
+12027 | Bacteriophage SP | | equivalent name
+12027 | Enterobacteria phage SP | | scientific name
+12027 | phage SP | | equivalent name
+12030 | Bacteriophage TW19 | | equivalent name
+12030 | Enterobacteria phage TW19 | | scientific name
+12031 | Bacteriophage TW28 | | equivalent name
+12031 | Enterobacteria phage TW28 | | scientific name
+12031 | phage TW19 | | equivalent name
+12031 | phage TW28 | | equivalent name
+12036 | Luteovirus | | scientific name
+12036 | Luteovirus subgroup I | | equivalent name
+12050 | Maize chlorotic dwarf virus group | | equivalent name
+12050 | Waikavirus | | scientific name
+12051 | Marafivirus | | scientific name
+12058 | Picornaviridae | | scientific name
+12058 | Picornavirus | | synonym
+12059 | Enterovirus | | scientific name
+12059 | Enteroviruses | | equivalent name
+12059 | Rhinovirus | | includes
+12059 | Rhinoviruses | | includes
+12059 | common cold viruses | | includes
+12091 | Hepatovirus | | scientific name
+12109 | Aphthovirus | | scientific name
+12109 | Aphthoviruses | | equivalent name
+12137 | Sobemovirus | | scientific name
+12137 | Velvet tobacco mottle virus group | | equivalent name
+12141 | Tombusvirus | | scientific name
+12160 | Closterovirus | | scientific name
+12163 | Carlavirus | | scientific name
+12174 | Capillovirus | | scientific name
+12176 | Potexvirus | | scientific name
+12195 | Potyvirus | | scientific name
+12234 | Tobamoviridae | | equivalent name
+12234 | Tobamovirus | | scientific name
+12258 | Comovirus | | scientific name
+12270 | Nepovirus | | scientific name
+12283 | Nodaviridae | | scientific name
+12289 | Enamovirus | | scientific name
+12289 | Pea enation mosaic virus group | | equivalent name
+12316 | Ilarvirus | | scientific name
+12429 | unassigned viruses | | equivalent name
+12429 | unclassified virus | | equivalent name
+12429 | unclassified viruses | | scientific name
+12456 | HAstV-1 | | acronym
+12456 | Human astrovirus 1 | | scientific name
+12456 | Human astrovirus type 1 | | equivalent name
+12456 | human astrovirus serotype 1 | | equivalent name
+12471 | Solanum nodiflorum mottle virus | | scientific name
+12701 | H-Ast2 | | acronym
+12701 | Human astrovirus 2 | | scientific name
+12701 | Human astrovirus serotype 2 H-Ast2 | | equivalent name
+12701 | Human astrovirus type 2 | | equivalent name
+12877 | Satellites | | synonym
+12877 | unclassified satellites | | scientific name
+12929 | Amazona | | scientific name
+13366 | Brettanomyces | | scientific name
+13366 | Brettanomyces N.H. Claussen ex Custers, 1940 | | authority
+13366 | Dekkera | | synonym
+13366 | Eeniella | | synonym
+13502 | ATCC 48014 | ATCC 48014 | type material
+13502 | Brettanomyces nanus | | scientific name
+13502 | Brettanomyces nanus (M.T. Sm., Bat. Vegte & Scheffers) M.T. Sm., Boekhout, Kurtzman & O'Donnell, 1994 | | authority
+13502 | CBS 1945 | CBS 1945 | type material
+13502 | CCRC 21335 | CCRC 21335 | type material
+13502 | CCRC:21335 | CCRC:21335 | type material
+13502 | Eeniella nana | | synonym
+13502 | Eeniella nana M.T. Sm., Bat. Vegte & Scheffers, 1981 | | authority
+13502 | NRRL Y-17527 | NRRL Y-17527 | type material
+13502 | specimen-voucher:NRRL:Y:17527 | specimen-voucher:NRRL:Y:17527 | type material
+14366 | Cymbidium | | scientific name
+14366 | Cymbidium Sw., 1799 | | authority
+16360 | Alismatales | | scientific name
+16360 | Alismatales R.Br. ex Bercht. & J.Presl, 1820 | | authority
+16360 | Alismatiflorae | | in-part
+16360 | Arales | | includes
+16360 | Arales Lindl.,1833 | | authority
+16360 | Ariflorae | | in-part
+16360 | Najadales | | includes
+16360 | Najadales Dumort., 1929 | | authority
+16360 | Spathiflorae | | synonym
+16360 | Zosterales | | includes
+16360 | Zosterales J.Presl, 1846 | | authority
+23461 | Mangifera | | scientific name
+23461 | Mangifera L. | | authority
+24966 | Dialypetalanthaceae | | includes
+24966 | Dialypetalanthaceae Rizzini & Occhioni, 1948 | | authority
+24966 | Rubiaceae | | scientific name
+24966 | Rubiaceae Juss., 1789 | | authority
+24966 | madder family | | common name
+25623 | Taxaceae | | scientific name
+25623 | Taxaceae Gray, 1822 | | authority
+25623 | yew family | | common name
+25628 | Taxus | | scientific name
+25628 | Taxus L. | | authority
+26473 | Buddleia | | synonym
+26473 | Buddleja | | scientific name
+26473 | Buddleja L., 1753 | | authority
+26867 | Bougueria | | synonym
+26867 | Plantago | | scientific name
+26867 | Plantago L. | | authority
+26867 | ribworts | | common name
+27319 | Metschnikowiaceae | | scientific name
+27319 | Metschnikowiaceae T. Kamienski ex Doweld, 2013 | | authority
+27337 | CBS 130341 | CBS 130341 | type material
+27337 | NRRL 54785 | NRRL 54785 | type material
+27337 | PD322 | PD322 | type material
+27337 | UC 1953893 | UC 1953893 | type material
+27337 | Verticillium dahliae | | scientific name
+27337 | Verticillium dahliae Klebahn, 1913 | | authority
+27434 | Dermaptera | | scientific name
+27434 | earwigs | earwigs | blast name
+27434 | earwigs | earwigs | genbank common name
+27483 | Evanioidea | | scientific name
+27592 | Bovinae | | scientific name
+27668 | Myotis leibii | | scientific name
+27668 | Vespertilio leibii | | synonym
+27668 | Vespertilio leibii Audubon & Bachman, 1842 | | authority
+27668 | eastern small-footed myotis | | genbank common name
+27708 | Cyprinus conchonius | | synonym
+27708 | Cyprinus conchonius Hamilton, 1822 | | authority
+27708 | Pethia conchonius | | scientific name
+27708 | Pethia conchonius (Hamilton, 1822) | | authority
+27708 | Puntius conchonius | | synonym
+27708 | Puntius conchonius (Hamilton, 1822) | | authority
+27708 | rosy barb | | genbank common name
+27994 | Theileriidae | | scientific name
+27994 | Theileriidae du Toit, 1918 | | authority
+28267 | Phocine distemper virus-2 | | scientific name
+28725 | Corvidae | | scientific name
+28843 | Diphyllobothriidae | | scientific name
+28843 | Ligulidae | | synonym
+28890 | "Euryarchaeota" Woese et al. 1990 | | authority
+28890 | "Methanobacteraeota" Oren et al. 2015 | | authority
+28890 | "Methanobacteriota" Whitman et al. 2018 | | authority
+28890 | Euryarchaeota | | synonym
+28890 | Euryarchaeota Garrity and Holt 2002 | | authority
+28890 | Methanobacteraeota | | synonym
+28890 | Methanobacteriota | | scientific name
+28890 | Methanobacteriota Garrity and Holt 2023 | | authority
+28890 | euryarchaeotes | euryarchaeotes | blast name
+28890 | euryarchaeotes | euryarchaeotes | genbank common name
+29961 | Parastacoidea | | scientific name
+29962 | Grapsidoidea | | synonym
+29962 | Grapsoidea | | scientific name
+30092 | Psyllidae | | scientific name
+30093 | Trioza | | scientific name
+30093 | Trioza Foerster, 1848 | | authority
+30102 | Cicadellidae | | scientific name
+30102 | Jassidae | | synonym
+30102 | leafhoppers | | genbank common name
+30367 | Ambystomatoidea | | synonym
+30367 | Salamandroidea | | scientific name
+30388 | Chaja torquata | | synonym
+30388 | Chaja torquata Oken, 1816 | | authority
+30388 | Chauna torquata | | scientific name
+30388 | southern screamer | | genbank common name
+30449 | Procellariiformes | | scientific name
+30449 | petrels and albatrosses | | genbank common name
+30560 | Microchiroptera | | synonym
+30560 | Vespertilioniformes | | synonym
+30560 | Yangochiroptera | | scientific name
+30725 | Catostomoidea | | synonym
+30725 | Cobitoidei | | scientific name
+30727 | Cyprinoidea | | synonym
+30727 | Cyprinoidei | | scientific name
+30806 | Channichthyidae | | scientific name
+30806 | crocodile icefishes | | genbank common name
+30806 | white-blooded fish | | common name
+30871 | Serranidae | | scientific name
+30871 | sea basses | | genbank common name
+30942 | Pleuronectoidei | | scientific name
+30942 | Soleoidei | | synonym
+31271 | Plasmodium chabaudi chabaudi | | scientific name
+31370 | Batrachospermales | | scientific name
+31371 | Batrachospermaceae | | scientific name
+31371 | Brachtospermaceae | | synonym
+31468 | Gracilariales | | scientific name
+31469 | Gracilariaceae | | scientific name
+31612 | Adelaide River virus | | scientific name
+31870 | CBS 130836 | CBS 130836 | type material
+31870 | Colletotrichopsis graminicola | | synonym
+31870 | Colletotrichum graminicola | | scientific name
+31870 | Colletotrichum graminicola (Ces.) G.W. Wilson, 1914 | | authority
+31870 | Dicladium graminicola | | synonym
+31870 | Dicladium graminicola Ces., 1852 | | authority
+31870 | Dicladium graminicolum | | synonym
+31870 | Glomerella graminicola | | synonym
+31870 | Glomerella graminicola D.J. Politis, 1975 | | authority
+31870 | M1.001 | M1.001 | type material
+31870 | Steirochaete graminicola | | synonym
+32443 | Teleostei | | scientific name
+32443 | teleost fishes | | genbank common name
+32519 | Ostariophysi | | scientific name
+32523 | Tetrapoda | | scientific name
+32523 | tetrapods | | genbank common name
+32524 | Amniota | | scientific name
+32524 | amniotes | | genbank common name
+32525 | Theria | Theria | scientific name
+32525 | Theria Parker & Haswell, 1897 | | authority
+32561 | Diapsida | | synonym
+32561 | Sauria | | scientific name
+32561 | diapsids | | genbank common name
+32613 | Ephemerovirus | | scientific name
+32620 | Iris severe mosaic virus | | scientific name
+33090 | Chlorobionta | | synonym
+33090 | Chlorobionta Jeffrey, 1982 | | authority
+33090 | Chlorophyta/Embryophyta group | | equivalent name
+33090 | Chloroplastida | | synonym
+33090 | Chloroplastida Adl et al. 2005 | | authority
+33090 | Viridiplantae | | scientific name
+33090 | Viridiplantae Cavalier-Smith, 1981 | | authority
+33090 | chlorophyte/embryophyte group | | equivalent name
+33090 | green plants | green plants | blast name
+33090 | green plants | green plants | common name
+33154 | Fungi/Metazoa group | | synonym
+33154 | Opisthokonta | | scientific name
+33154 | Opisthokonta Cavalier-Smith 1987 | | authority
+33154 | opisthokonts | | synonym
+33183 | Arachnomycetales | | synonym
+33183 | Arachnomycetales Gibas, Sigler & Currah, 2002 | | authority
+33183 | Ascosphaerales | | synonym
+33183 | Gymnoascales | | synonym
+33183 | Onygenales | | scientific name
+33183 | Onygenales Cif. ex Benny & Kimbr., 1980 | | authority
+33184 | Amauroascaceae | | synonym
+33184 | Amauroascaceae Arx, 1987 | | authority
+33184 | Onygenaceae | | scientific name
+33184 | Onygenaceae E. Fisch., 1898 | | authority
+33208 | Animalia | | synonym
+33208 | Metazoa | | scientific name
+33208 | animals | animals | blast name
+33208 | animals | animals