diff --git a/.gitignore b/.gitignore new file mode 100644 index 0000000..6a31006 --- /dev/null +++ b/.gitignore @@ -0,0 +1,2 @@ +subworkflows/prepare_input_visium_hd.nf +.claude/ \ No newline at end of file diff --git a/Dockerfile b/Dockerfile deleted file mode 100644 index 57d6157..0000000 --- a/Dockerfile +++ /dev/null @@ -1,56 +0,0 @@ -FROM debian:bookworm-slim - -MAINTAINER lingminhao - -# install all required CLI tools -RUN apt-get update \ - && apt-get install -y wget make g++ git-all zlib1g zlib1g-dev r-base python-is-python3 python3-pip software-properties-common \ - ca-certificates gnupg2 libssl-dev libcurl4-gnutls-dev libxml2-dev libfontconfig1-dev libharfbuzz-dev libfribidi-dev libfreetype6-dev libpng-dev libtiff5-dev libjpeg-dev - -RUN wget -q https://cloud.r-project.org/bin/linux/debian/key_4.1.2 -O cran-key.asc \ - && gpg --import cran-key.asc \ - && mv cran-key.asc /etc/apt/trusted.gpg.d/cran.gpg - -RUN add-apt-repository -y 'deb http://cloud.r-project.org/bin/linux/debian bookworm-cran40/' \ - && apt update \ - && apt-get install -y r-base - -# make a directory to store all required softwares -RUN mkdir mnt/software - -# install flexiplex -RUN cd mnt/software && wget https://github.com/DavidsonGroup/flexiplex/releases/download/v1.01/flexiplex-1.01.tar.gz \ - && tar -xvf flexiplex-1.01.tar.gz && rm flexiplex-1.01.tar.gz && cd flexiplex-1.01 && make - -# install jaffa -RUN cd mnt/software && wget https://github.com/Oshlack/JAFFA/releases/download/version-2.3/JAFFA-version-2.3.tar.gz \ - && tar -xvf JAFFA-version-2.3.tar.gz && rm JAFFA-version-2.3.tar.gz && cd JAFFA-version-2.3 $$ ./install_linux64.sh - -# install minimap2 -RUN cd mnt/software && git clone https://github.com/lh3/minimap2 \ - && cd minimap2 && make - -# install samtools -RUN cd mnt/software && wget https://github.com/samtools/htslib/releases/download/1.18/htslib-1.18.tar.bz2 \ - && tar -xvf htslib-1.18.tar.bz2 && rm htslib-1.18.tar.bz2 && cd htslib-1.18 && make && make install \ - && wget https://github.com/samtools/samtools/releases/download/1.18/samtools-1.18.tar.bz2 \ - && tar -xvf samtools-1.18.tar.bz2 && rm samtools-1.18.tar.bz2 && cd samtools-1.18 && make && make install - -# install bambu -RUN cd mnt/software && R -e "install.packages('devtools')" -RUN cd mnt/software && R -e "install.packages('R.utils')" -RUN cd mnt/software && R -e "install.packages('BiocManager')" -RUN cd mnt/software && R -e "BiocManager::install('bambu')" -RUN cd mnt/software && git clone -b messyForest --single-branch https://github.com/GoekeLab/bambu.git -RUN cd mnt/software && R -e "library('devtools'); load_all('bambu')" -RUN cd mnt/software && R -e "install.packages('Rcpp')" - -RUN cd mnt/software && wget https://raw.githubusercontent.com/DavidsonGroup/flexiplex/863a5f3b182a0ee669407406b6cb39ae9f7f0c76/scripts/filter-barcodes.py \ - && pip3 install numpy pandas --break-system-packages - -RUN cd mnt/software/bambu && chmod 777 DESCRIPTION - -RUN apt-get install -y libopenblas-dev - -# environment variables -ENV PATH=$PATH:/mnt/software/flexiplex-1.01:/mnt/software/minimap2:/mnt/software/samtools-1.18:/mnt/software/htslib-1.18:/mnt/software/bambu diff --git a/README.md b/README.md index 5dd9ace..bc67fbd 100644 --- a/README.md +++ b/README.md @@ -1,250 +1,283 @@ -# **BETA** -Not in a final state, please do not use unless you are a tester and know how to use it. - # **Context-Aware Transcript Quantification from Long Read Single-Cell and Spatial Transcriptomics data** -This is a pipeline developed for context-aware transcript discovery and quantification from long read single-cell and spatial transcriptomics data. The pipeline consists of 4 steps, barcode/UMI identification and demultiplexing with [flexiplex](https://davidsongroup.github.io/flexiplex/), genome alignment with minimap 2, and transcript discovery and quantification with [Bambu](https://github.com/GoekeLab/bambu/tree/BambuDev). The final output includes novel transcripts found in the sample and transcript level count matrices for each barcode/coordinate. +This pipeline performs context-aware transcript discovery and quantification from long read single-cell and spatial transcriptomics data. The workflow consists of: +1. (Optional) Quality score filtering with [chopper](https://github.com/wdecoster/chopper) +2. Barcode/UMI identification and demultiplexing with [flexiplex](https://davidsongroup.github.io/flexiplex/) +3. Primer removal with [cutadapt](https://cutadapt.readthedocs.io/en/stable/) +4. Genome alignment with [minimap2](https://lh3.github.io/minimap2/minimap2.html) +5. Transcript discovery and quantification with [Bambu](https://github.com/GoekeLab/bambu/tree/BambuDev). + +The final output includes novel transcripts found in the sample and transcript level count matrices for each barcode/spatial coordinate. + -### **Content** +### **Content** - [Installation](#installation) -- [General Usage](#General-Usage) -- [Release History](#Release-History) -- [Citation](#Citation) -- [Contributors](#Contributors) +- [General Usage](#general-usage) +- [Samplesheet (CSV)](#samplesheet-csv) +- [Supported 10x Library Chemistries](#supported-10x-library-chemistries) +- [Parameters](#parameters) +- [Output](#output) +- [Spatial Analysis](#spatial-analysis) +- [Advanced Usage](#advanced-usage) +- [Additional Information](#additional-information) +- [Release History](#release-history) +- [Citation](#citation) +- [Contributors](#contributors) ### **Installation** -To run this pipeline, you will need [Nextflow](https://www.nextflow.io/docs/latest/install.html) and [Docker](https://docs.docker.com/engine/install/ubuntu/) (or [Singularity](https://docs.sylabs.io/guides/3.0/user-guide/installation.html_) if you do not have user rights for docker). The latest version is recommended. Note that you mad need to had java to your path if it is not already there. +Install the following dependencies before running the pipeline: +- [Nextflow](https://www.nextflow.io/docs/latest/install.html) +- [Docker](https://docs.docker.com/engine/install/ubuntu/) (or [Singularity](https://docs.sylabs.io/guides/3.0/user-guide/installation.html_) if you do not have user permissions for Docker). -### **General Usage** -The pipeline can be run with one line, providing either the path directly to your input fastq/bam file or a samplesheet when running multiple samples. Below are example use cases which you can test using example data that comes with the container. +The latest version for each dependency is recommended. -You may need to specify -r main depending on your local environment. -Currently investigating issues when running on high performance clusters and pathing to the container. -Note that in the examples that while we do not provide a whitelist paramter, it is generally recommended to do so. See arguments below. -**Running a single sample** -``` -nextflow run GoekeLab/bambu-singlecell-spatial \ - --reads $PWD/examples/reads_chr9_1_1000000.fastq.gz \ - --genome $PWD/examples/Homo_sapiens.GRCh38.dna_sm.primary_assembly_chr9_1_1000000.fa \ - --annotation $PWD/examples/Homo_sapiens.GRCh38.91_chr9_1_1000000.gtf \ - --chemistry 10x5v2 \ - --ncore 16 --outdir output \ - -with-singularity lingminhao/bambusc:beta1.2 -``` +### **General Usage** +To run the pipeline, you must provide a samplesheet, reference genome, and reference annotation file as input. The pipeline performs transcript discovery and quantification on either a single sample or on multiple samples based on the number of samples specified in the samplesheet. Refer to the [Parameters](#parameters) and [Samplesheet (CSV)](#samplesheet-csv) sections below for more details. -**Running multiple samples** +**Running the pipeline** + +Use the command below to run the pipeline on the test data provided in `examples/` ``` -nextflow run GoekeLab/bambu-singlecell-spatial \ - --reads $PWD/examples/samplesheet_basic.csv \ # See the arguments section for format specifications +nextflow run $PWD/bambu-singlecell-spatial \ + --input $PWD/examples/samplesheet.csv \ --genome $PWD/examples/Homo_sapiens.GRCh38.dna_sm.primary_assembly_chr9_1_1000000.fa \ --annotation $PWD/examples/Homo_sapiens.GRCh38.91_chr9_1_1000000.gtf \ - --chemistry 10x5v2 \ #can be provided in the samplesheet instead - --ncore 16 --outdir output \ - -with-singularity lingminhao/bambusc:beta1.2 + -profile singularity,hpc ``` -examples/samplesheet_basic.csv -| sample | fastq | -|:---|:----------| -| replicate1 | reads_chr9_1_1000000.fastq.gz | -| replicate2 | reads_chr9_1_1000000_rep2.fastq.gz | -**Running from a demultiplexed bam (skip demultiplexing and alignment)** -``` -nextflow run GoekeLab/bambu-singlecell-spatial \ - --bams $PWD/examples/demultiplexed.bam \ # See the arguments section for demutiplex format requirements - --genome $PWD/examples/Homo_sapiens.GRCh38.dna_sm.primary_assembly_chr9_1_1000000.fa \ - --annotation $PWD/examples/Homo_sapiens.GRCh38.91_chr9_1_1000000.gtf \ - --ncore 16 --outdir output \ - -with-singularity lingminhao/bambusc:beta1.2 -``` +**Nextflow Profiles** -You can run the code above with your own dataset by replacing the arguments accordingly. The pipeline works on both the **long read sequencing** platform Oxford Nanopore Technologies (ONT) and PacBio at the single-cell and spatial level. The description for each argument is shown below: +To configure the executor and container used by the pipeline, pass the following profile types through the `-profile` argument in Nextflow. -### **Required arguments** +Container profiles: +- `singularity`: use Singularity images (recommended on HPC systems) +- `docker`: use Docker images -The BambuSC pipeline can be started from from raw reads (fastq.gz) or from a demultiplexed .bam file if you have already produced these (from earlier runs of this pipeline or other upstream tools). Therefore either the --reads or --bams argument is mandatory depending on your input files. +Executor profiles: +- `hpc`: execute pipeline on an HPC system -**--reads** [PATH] - a path to one read file (.fastq.gz) from a single-cell or spatial experiment run. +Note: By default, the executor for the `hpc` profile is set to 'slurm'. To change this, modify the nextflow.config file. -Multiple Samples: -If running multiple samples you can instead path to a csv samplesheet. Samples with the same 'sample' name will be combined together and treated as one sample (for example when combining technical replicates that have the same barcodes). See the following argument descriptions on how the samplesheet can be filled out. +### **Samplesheet (CSV)** -Running Multiple Similiar Samples -| sample | fastq | -|:---|:----------| -| replicate1 | path/to/1.fastq.gz | -| replicate2 | path/to/2.fastq.gz | -| replicate3 | path/to/3.run1.fastq.gz | -| replicate3 | path/to/3.run2.fastq.gz | +The pipeline requires a `.csv` formatted samplesheet to define the input data. This file is mandatory, regardless of the number of samples being processed. Each row in the samplesheet represents a single sample and its corresponding file path and metadata. -Additionally if your multiple samples require different parameters for demultiplexing and alignment you can provide these in the samplesheet. If any of the chemistry, technology, or whitelist columns are not provided, or if there is a missing entry, the pipeline will use the input from the --chemistry --technology and --whitelist arguments respectively for the samples. +**Required Columns** -Multiple Sample with different parameters example: (examples/samplesheet_custom_example.csv) -| sample | fastq | chemistry | technology | whitelist | -|:---|:----------|:------|:------|:------| -| 3prime_1 | path/to/1.fastq.gz | 10x3v2 | ONT | path/to/whitelist.gz | -| 3prime_2 | path/to/2.fastq.gz | 10x3v2 | ONT | path/to/whitelist.gz | -| 3prime_3_PacBio | path/to/3.fastq.gz | 10x3v2 | PacBio | path/to/whitelist.gz | -| customSample1 | path/to/4.fastq.gz | -x CTACACGACGCTCTTCCGATCT -b ???????????? -u ???????????? -x TTTTTTTTT | ONT | path/to/whitelist_custom.gz | -| customSample2 | path/to/5.fastq.gz | -x CTACACGACGCTCTTCCGATCT -b ???????????? -u ???????????? -x TTTTTTTTT | ONT | path/to/whitelist_custom.gz | -| customSample3_PacBio | path/to/6.fastq.gz | -x CTACACGACGCTCTTCCGATCT -b ???????????? -u ???????????? -x TTTTTTTTT | PacBio | path/to/whitelist_custom.gz | +The samplesheet must include the following columns: +- `sample`: sample name (no spaces and non-alphanumeric characters) +- `path`: path to the input file (FASTQ, BAM, or RDS) +- `chemistry`: 10x library chemistry (see [Supported 10x Library Chemistries](#supported-10x-library-chemistries)) +- `technology`: sequencing technology (`ONT` or `PacBio`) -**--bams** [PATH] - If you did demultiplexing and alignment seperately, you can start the pipeline at the bambu step. Requires a path to the alignment file (.bam). The bam file must be demultiplexed in one of the following 3 ways: +Note: The first row of the samplesheet must be a header containing the exact column names: `sample`, `path`, `chemistry`, and `technology`. -1. The read names have the barcode and UMI sequences appended to the start of the name: e.g. `ATCCGTCCAACGGGTA_TTGCTGGCGTGT#46f0ce76-6a12-4a12-a707-2ffef7be7594_+1of1`. The first set of characters (`ATCCGTCCAACGGGTA`) followed by an '_' refer to the cell barcode (CB) and the next set of characters after the underscore (`TTGCTGGCGTGT`) followed by a '#' refers to the unique molecular identifier (UMI). If there is no UMI in your data this set can be empty and no UMI deduplication will be performed, but ensure the underscore and hash are still present so that the bam file name can be correctly parsed. +**Supported Input Formats** -2. The barcode is located in the BC tag in the bam file, and the UMI is located in the UG tag +The pipeline is designed to be flexible. Depending on your starting point in the workflow, the `path` column can point to the following file types: +- **FASTQ**: Raw reads (compressed `.gz` or uncompressed) +- **BAM**: Demultiplexed and aligned reads +- **RDS**: Pre-processed bambu read class objects -3. The --barcodeMap argument is provided in (or as a column in the samplesheet) to a .tsv or .csv with three columns. All reads not present in the table will be discarded from the analysis. The UMI column is optional if you do not need UMI deduplication or do not have UMIs in your data. +For more details on starting the pipeline from specific stages, please refer to the [Advanced Usage]() section. -Example: NO HEADER IN FILE (see examples/barcode_map_example.csv) +**Example Samplesheet (Single Sample)** +```csv +sample,path,chemistry,technology +sample1,path/to/sample1_fastq.gz,10x3v2,ONT +``` -| Read Name | Barcode | UMI | -|:---|:----------|:------| -| #46f0ce76-6a12-4a12-a707-2ffef7be7594 | ATCCGTCCAACGGGTA | TTGCTGGCGTGT | +**Example Samplesheet (Multiple Samples)** +```csv +sample,path,chemistry,technology +sample1,path/to/sample1_fastq.gz,10x3v2,ONT +sample2,path/to/sample2_fastq.gz,10x3v3,PacBio +sample3,path/to/sample3_fastq.gz,10x3v4,ONT +``` -Multiple Samples: +Note: A samplesheet template is provided at `examples/samplesheet.csv`. +If all samples share the same library chemistry and/or sequencing technology, you may omit the `chemistry` and `technology` columns and use the `--chemistry` and `--technology` flags instead. -If running multiple samples you can instead path to a csv sample sheet containing the parameters neede for each sample. Samples with the same 'sample' name will be combined together and treated as one sample (for example when combining technical replicates that have the same barcodes). See the following argument descriptions on how the samplesheet can be filled out. Providing a barcode map is optional, and only required if the bam file does not contain the barcode information. Providing a spatial_whitelist is only required if using spatial data, and each sample uses a different whitelist/coordinates, otherwise it will use the whitelist providied by the --whitelist argument. -Multiple Sample Example (examples/samplesheet_bam_example.csv): -| sample | bam | barcode_map | spatial_whitelist -|:---|:----------|:------|:------| -| condition1 | path/to/demultiplexed.bam | | | -| condition2 | path/to/not_demultiplexed.bam | path/to/condition2_barcode_map.csv | | +### **Supported 10x Library Chemistries** +The following single cell and spatial library chemistries are supported. Please specify the sample chemistry in the samplesheet as shown: +- `10x3v2` (Single Cell 3' v2) +- `10x3v3` (Single Cell 3' v3 & Next GEM Single Cell 3' v3.1) +- `10x3v4` (GEM-X Single Cell 3' v4) +- `10x5v2` (Single Cell 5' v2) +- `10x5v3` (GEM-X Single Cell 5' v3) +- `visium-v1` (Visium Spatial Gene Expression Slide 6.5 mm; serial prefix V1) +- `visium-v2` (Visium Spatial Gene Expression Slide 6.5 mm; serial prefix V2) +- `visium-v3` (Visium Spatial Gene Expression Slide 6.5mm; serial prefix V3) +- `visium-v4` (Visium CytAssist Spatial Gene Expression Slide 6.5mm; serial prefix V4) +- `visium-v5` (Visium CytAssist Spatial Gene Expression Slide 11mm; serial prefix V5) -**--genome** [PATH] - a path to the genome fasta file. in the event you are running the pipeline using a bam file, this should be the same file used for read alignment. -**--annotation** [PATH] - a path to the reference annotation file (.gtf), a txdb object, or annotations object prepared by prepareAnnotations(). When not provided, de novo transcript discovery is performed. (see [Bambu](https://github.com/GoekeLab/bambu) for more information) +### **Parameters** -**--chemistry** [10x3v2/10x3v3/10x5v2/STRING] - type of 10X Genomics chemistry used in the single-cell or spatial experiment +**Mandatory** +- `--input` [string]: Path to the samplesheet .csv file +- `--genome` [string]: Path to the reference genome .fa or .fasta file +- `--annotation` [string]: Path to the reference annotation .gtf or .gff file -| Choice of argument | Description | -|:---|:----------------| -| 10x3v2 | 10x 3' version 2| -| 10x3v3 | 10x 3' version 3| -| 10x5v2 | 10x 5' version 2| +**Optional** +- `--outdir` [string, default: 'output']: Path to the output directory +- `--chemistry` [string, default: null]: Specify if all samples in the samplesheet share the same library chemistry +- `--technology` [string, default: null]: Specify if all samples in the samplesheet share the same sequencing technology +- `--early_stop_stage` [string, default: null]: Stop the pipeline early and output intermediate files (see Advanced Usage section). Options: + - "bam": Stops pipeline after minimap2 alignment + - "rds": Stops pipeline after Bambu read class construction +- `--qscore_filtering` [boolean, default: true]: Enable or disable quality score filtering of reads +- `--ndr` [float, default: null]: NDR threshold for Bambu transcript discovery. If not set, Bambu will recommend a suitable value +- `--deduplicate_umis` [boolean, default: true]: If true, Bambu will perform UMI deduplication +- `--quantification_mode` [string, default: "EM_clusters"]: Quantification mode for transcript counts. Available options are: + - "no_quant": Transcript quantification is not performed + - "EM": Performs transcript quantification for each cell/spatial coordinate + - "EM_clusters": Performs pseudo-bulk clustering using [Seurat](https://satijalab.org/seurat/) followed by transcript quantification at the cluster level +- `--resolution` [float, default: 0.8]: Seurat clustering resolution -Advanced use: If your sample was not barcoded by one of the above chemistries you can provide a custom search string as detailed in the flexiplex documentation (https://davidsongroup.github.io/flexiplex/). e.g --chemistry '-x CTACACGACGCTCTTCCGATCT -b ???????????????? -u ?????????? -x TTTTTTTTT' ### **Output** ### +All outputs from the pipeline are written to the directory specified by the `--outdir` parameter. The pipeline produces per-sample alignment files, per-sample read class files used by Bambu, and the combined transcript discovery and quantification results. The examples below show the output directory structure for both single and multi-sample runs: + +**Output Structure (Single Sample)** +``` +output/ +├── bam/ +│ ├── sample1_demultiplexed.bam +│ └── sample1_demultiplexed.bam.bai +│ +├── read_class/ +│ └── sample1_readClassFile.rds +│ +├── sample1_extended_annotations.gtf +└── sample1_se.rds +``` + +**Output Structure (Multiple Samples)** +``` +output/ +├── bam/ +│ ├── sample1_demultiplexed.bam +│ ├── sample1_demultiplexed.bam.bai +│ ├── sample2_demultiplexed.bam +│ └── sample2_demultiplexed.bam.bai +│ +├── read_class/ +│ ├── sample1_readClassFile.rds +│ └── sample2_readClassFile.rds +│ +├── combined_extended_annotations.gtf +└── combined_se.rds +``` + +Note: For single sample runs, the `extended_annotations.gtf` and `se.rds` are prefixed with the `sample_name`. For multi-sample runs, the `combined` prefix is used instead. + +**Description of the Output Files** +| File | Description +|---|--- +| _demultiplexed.bam | BAM file containing demultiplexed, trimmed and aligned reads +| _demultiplexed.bam.bai | BAM index for the corresponding BAM file +| _readClassFile.rds | An intermediate metadata file used by Bambu that contains the constructed read classes. This file can be used as input in subsequent runs to bypass the initial preprocessing and alignment steps. +| *_extended_annotations.gtf | A `.gtf` file containing the novel transcripts discovered by Bambu as well as the reference annotations provided by the user. +| *_se.rds | A [RangedSummarizedExperiment](https://www.rdocumentation.org/packages/SummarizedExperiment/versions/1.2.3/topics/RangedSummarizedExperiment-class) object containing count matrices (`.mtx`) from transcript quantification by Bambu. Depending on the `quantification_mode`, the matrices are provided at either pseudobulk or single-cell level. The rows of the matrices represent transcript names, while the columns follow the `sampleName_cellBarcode` or `sampleName_clusterId` naming convention. + +**Count Matrices** + +The [RangedSummarizedExperiment](https://www.rdocumentation.org/packages/SummarizedExperiment/versions/1.2.3/topics/RangedSummarizedExperiment-class) object contains four distinct types of count matrices, which can be accessed in R using the `assays()` function. Depending on your analysis requirements you can choose from the following: +- `counts`: expression estimates +- `CPM`: seqencing depth normalised estimates +- `fullLengthCounts`: estimates of read counts mapped as full length reads for each transcript +- `uniqueCounts`: counts of reads that are uniquely mapped to each transcript -After the run, all the outputs will be stored in the folder specified by the `--outdir` parameter. The output files are described below and are in 3 categories: General, Single Cell Level, Pseudobulk/EM Level - - General -| Output file name | Description | -|:----------------------|:------------------------------------------| -| extended_annotations.gtf | Extended transcript & gene annotations for the genome using long reads data. | -| txANDGenes.tsv | Gene ID associated to each transcript arranged as in the transcript count estimates | -| genes.tsv | Gene ID arranged as in the gene count estimates | -| extended_annotations_NDR1.gtf | A gtf file containing all potential transcript models and their NDR score from Bambu (maximum sensitivity). | - -Single-Cell Level -| Output file name | Description | -|:----------------------|:------------------------------------------| -| counts_transcript.mtx | Total read counts estimates for each transcript in each sample (sparse matrix format). | -| counts_gene.mtx | Gene read counts estimates for each transcript in each sample. | -| incompatibleCounts.mtx | The counts that are unable to be assigned to transcripts per gene. | -| sampleData.tsv | Information for the columns for each sparse matrix. Includes if provided the sample names, barcodes, and x and y coordinates (for spatial) | - -Pseudobulk/EM Level -If clusters = "none" then this was also be at the single-cell level. See clusters -| Output file name | Description | -|:----------------------|:------------------------------------------| -| counts_transcript.mtx | Total read counts estimates for each transcript in each sample (sparse matrix format). | -| CPM_transcript.mtx | Counts per million (CPM) estimates for each transcript in each sample (sparse matrix format). | -| fullLengthCounts_transcript.mtx | Full length read counts estimates for each transcript in each sample (sparse matrix format). | -| uniqueCounts_transcript.mtx | Unique read counts estimates for each transcript in each sample (sparse matrix format). | -| counts_gene.mtx | Gene read counts estimates for each transcript in each sample. | -| incompatibleCounts.mtx | The counts that are unable to be assigned to transcripts per gene. | -| sampleData.tsv | Information for the columns for each sparse matrix. Includes if provided the sample names, barcodes, and x and y coordinates (for spatial) | -| cellMixs.rds | PLACEHOLDER | -| clusters.rds | PLACEHOLDER | - - -You may then use these count matrices for downstream analysis using tools like [Seurat](https://satijalab.org/seurat/) or [scanpy](https://www.google.com/search?q=scanpy&oq=scanpy&aqs=chrome..69i57.866j0j7&sourceid=chrome&ie=UTF-8). The following short tutorials demonstrate how to analyse the long read [single-cell]() and [spatial]() data using [Seurat](https://satijalab.org/seurat/). These can also be reloaded into R using importBambu("/path/to/outputDir") -### **Optional arguments** +### **Spatial Analysis** ## +The pipeline applies the same processing steps to both single-cell and spatial samples. However, for spatial data, the generated `SummarizedExperiment` object is appended with spatial mapping information, which is stored in `colData`. -**--whitelist** [PATH] - a path to the `gzipped` cell/spot barcode whitelist or the name of the barcode list ([single-cell](https://kb.10xgenomics.com/hc/en-us/articles/115004506263-What-is-a-barcode-whitelist-) / [spatial](https://kb.10xgenomics.com/hc/en-us/articles/360041426992-Where-can-I-find-the-Space-Ranger-barcode-whitelist-and-their-coordinates-on-the-slide-)) provided by 10X Genomics. It is recommended to provide the correct whitelist as it is used as a reference to filter against low confidence putative barcodes, however you may also run this pipeline without providing it +**Example - Spatial Mapping Information (`visium-v*`)**: -**--spatial** - a flag to tell the pipeline this is spatial data. If set, the --whitelist needs to also be set and additionally contain the X and Y coordinates for each barcode in two additional columns (tsv with no header). See #Spatial Analysis below for more details +For `visium-v*` samples, `colData` contains the spatial barcode and the corresponding X and Y spatial coordinates. -**--fusionMode** - Will run JAFFAL to identify fusion breakpoints and then bambu to identify and quantify fusion transcripts at the single-cell level +| Barcode | X coordinate | Y coordinate| +|:---|:---|:---| +| AAACAACGAATAGTTC | 17 | 1 | +| AAACAAGTATCTCCCA | 103 | 51 | +| AAACAATCTACTAGCA | 44 | 4 | -**--flexiplex_e** [INT] - the edit distance used by flexiplex for barcode identification (default: 1) -**--technology** [ONT/PacBio]- the long read sequencing platform used to generate the reads [`ONT` or `PacBio`. default:`ONT`] -This changes the stringency of the alignment based on minimap2 recommendations. +### **Visium HD Spatial Analysis (Under Development)** -**--NDR** [FLOAT] - the NDR threshold used for Bambu transcript discovery. A value between 0 - 1, with lower values being more precise but less sensitive. Typically a value of 0.1 is suitable for most analyses. If you do not want transcript discovery set this value to 0. (default: automatically determined based on data) +This feature is still under development and will be released in a future update. -**--noEM** - When provided, the pipeline will not perform the final EM quantification step, and the final outputs will be the unique counts and gene counts summarised experiment objects -**--resolution** [FLOAT] - the resolution used for the default Seurat clustering before the EM when --clusters is not provided +### **Fusion Transcript Analysis (Under Development)** +This feature is still under development and will be released in a future update. -**--clusters** [PATH, default: 'auto'] - a path to a tsv or csv (without a header), where the first column contains the barcodes and the second column contains the cluster name. Clustering will be done across all samples with the same sample names. If --lowMemory is provided, clustering is done per input file, they are not combined. Find an example in examples/barcode_clusters_example.csv. Default is 'auto' which will automatically cluster the cells based on gene expression with limited filtering. For advanced use cases where there is sufficient read counts per cell, --clusters can be set to 'none' to have the EM appled to each cell individually. -| barcode | cluster_id | -|:---|:----------|:------| -| GCGCGATAGCTAACAA | cluster1 | -| TAGTGGTTCCTTTCTC | cluster1 | -| TCTGGAAAGGTGACCA | cluster2 | +### **Advanced Usage** -**--processByBam** [TRUE/FALSE. default: FALSE] - At the cost of runtime, but reducing the max memory the pipeline will use at one time, the pipeline will perform the bambu steps for each input file seperately. *Important* - because read class construction is done seperately using this mode, this will impact the transcripts that are discovered and the quantification results slightly due to small stocastic differences in junction error correction. +**Stopping the Pipeline Early** -**--processByChromosome** [TRUE/FALSE. default: TRUE]- At the cost of runtime, but reducing the max memory the pipeline will use at one time, the pipeline will perform the bambu steps for each chromosome seperately seperately. *Important* - because read class construction is done seperately using this mode, this will impact the transcripts that are discovered and the quantification results slightly due to small stocastic differences in junction error correction. +The `--early_stop_stage` parameter allows you to stop the pipeline at an intermediate stage and save the outputs for later use. This is useful when you want to inspect intermediate files or when you plan to re-run downstream steps separately. -**--ncore** [INT] - the number of cores to use in the run (default: `12`) +- `--early_stop_stage bam`: Stops after genome alignment. BAM files are saved to `output/bam/`. +- `--early_stop_stage rds`: Stops after Bambu read class construction. Read class `.rds` files are saved to `output/read_class/`. -**--cleanReads** [TRUE/FALSE] - if true, only the first supplimentary/primary alignment closest to the barcode is kept for analysis for each read name (default: 'true'). This reduces the liklihood of chimeric reads with undetected barcodes from leading to alignments being incorrectly assigned, however it means only the first alignment of fusion transcripts will be kept. +```bash +# Stop after read class construction +nextflow run $PWD/bambu-singlecell-spatial \ + --input samplesheet.csv \ + --genome reference.fa \ + --annotation reference.gtf \ + --early_stop_stage rds \ + -profile singularity,hpc +``` -**--deduplicateUMIs** [TRUE/FALSE] - if true, the longest alignment from the same barcode with the same UMI will be kept, and all others not included in the analysis. Set this to FALSE if UMIs are not provided in the demultiplexing of the bam (default: 'FALSE') +**Restarting from a Specific Stage** -**--outdir** [PATH] - the path to the output directory +Because the pipeline accepts FASTQ, BAM, or RDS files as input, you can restart from any intermediate stage by providing the corresponding files in your samplesheet. This avoids re-running expensive preprocessing and alignment steps when they have already been completed. -**--bambuPath** [PATH] - For advanced users. The path to a local version of Bambu which will be used instead of the containerized version +*Example: Incremental sample addition* -### **Multiple Sample Analysis** ### +A common use case is to process an initial set of samples through to read class `.rds` files, then re-run the full pipeline once additional samples are available. Transcript discovery and quantification in Bambu is performed jointly across all samples, so adding new samples requires re-running only from the `.rds` stage onward. -If you would like to analysis multiple samples or replicates, please note the following differences in the arguments. -The input to the --reads/--bams arguments needs to be a .csv file with all columns present. See the arguments section to ensure the formatting of the samplesheet.csv is correct and contains all the required information. -The sample column is used to distinguish different replicates and the sample name will be appended to the barcodes from that sample. Therefore if you would like to combine samples that share barcodes you can assign them the same sample name and their counts will be comined. -The same --genome and --annotation argument inputs will be applied to all samples. -An output file is produced for each sample prefixed with the sample name. +**Step 1** — Run the first batch of samples from FASTQ to `.rds`: +```bash +nextflow run $PWD/bambu-singlecell-spatial \ + --input samplesheet_batch1.csv \ + --genome reference.fa \ + --annotation reference.gtf \ + --early_stop_stage rds \ + -profile singularity,hpc +``` -### **Spatial Analysis** ## +This produces `output/read_class/sample1_readClassFile.rds`, `output/read_class/sample2_readClassFile.rds`, etc. -To run spatial data using Bambu, the X and Y coordinate mapping for each barcode to a spot needs to be provided as two additional columns in the whitelist (tab seperated). This file can generally be sourced from the provider of the library preperation. +**Step 2** — When new samples are ready, run all samples together from `.rds` for transcript discovery and quantification. Point the `path` column at the existing `.rds` files for the original samples and at the new FASTQ/BAM files for the new samples: -Example (**Headers are descriptive only, there should be no headers in the input file!**): -| Barcode | X coordinate | Y coordinate| -|:---|:---|:---| -| AAACAACGAATAGTTC | 17 | 1 | -| AAACAAGTATCTCCCA | 103 | 51 | -| AAACAATCTACTAGCA | 44 | 4 | +```csv +sample,path,chemistry,technology +sample1,output/read_class/sample1_readClassFile.rds,10x3v3,ONT +sample2,output/read_class/sample2_readClassFile.rds,10x3v3,ONT +sample3,path/to/sample3.fastq.gz,10x3v3,ONT +``` -### **Fusion Transcript Analysis** ## -Two extra parameters are required when running fusion mode -**--fusionMode** -**--jaffal_ref_dir** [PATH] - This needs to be a path to a JAFFA compatible reference. See JAFFAL documentation (https://github.com/Oshlack/JAFFA/wiki/FAQandTroubleshooting#how-can-i-run-jaffa-with-hg19-or-mm10) -When --fusionMode is provided to Bambu-Pipe, three additional steps are included in the pipeline. The first runs JAFFAL identifying the fusion genes breakpoint regions in the sample from the raw fastq files. The next step uses the identified breakpoints to generate artificial fusion scaffolds, placing the fused genes next to each other on their own scaffold. The final step runs Bambu-Clump using the fusion scaffolds and annotations, and will use the clustering provided by --clusters. +```bash +nextflow run $PWD/bambu-singlecell-spatial \ + --input samplesheet_all.csv \ + --genome reference.fa \ + --annotation reference.gtf \ + -profile singularity,hpc +``` -Outputs: +The pipeline will skip preprocessing and alignment for `sample1` and `sample2`, process `sample3` from FASTQ through to `.rds`, and then perform transcript discovery and quantification jointly across all three samples. -Fusion mode will produce the same outputs alongside the regular steps with the prefix of _fusion and _fusion_EM. The following fusion specific additional outputs are provided. -fusionGene.fasta - These are the fusion scaffolds which the reads are aligned too -fusion.gtf - These are the annotations used by bambu containing the two fused genes, which map to the fusionGene.fasta -jaffa_results.csv - These are the results from JAFFAL describing the fusion breakpoints used to generate the above files. ### **Additional Information** - UMI correction is done at the barcode level. The longest read for each unique barcode-UMI combination is kept for analysis. -To reduce the impact of chimeric reads, only the first alignment after the barcode will be used for analysis. - ### **Release History** Beta Release: 2023-May-03 @@ -253,6 +286,10 @@ Beta Release: 2023-May-03 Bambu Chen, Y., Sim, A., Wan, Y.K. et al. Context-aware transcript quantification from long-read RNA-seq data with Bambu. Nat Methods (2023). https://doi.org/10.1038/s41592-023-01908-w +Chopper + +Cutadapt + Flexiplex Oliver Cheng, Min Hao Ling, Changqing Wang, Shuyi Wu, Matthew E Ritchie, Jonathan Göke, Noorul Amin, Nadia M Davidson, Flexiplex: a versatile demultiplexer and search tool for omics data, Bioinformatics, Volume 40, Issue 3, March 2024, btae102, https://doi.org/10.1093/bioinformatics/btae102 @@ -264,4 +301,4 @@ Samtools Seurat ### **Contributors** -This package is developed and maintained by [Andre Sim](https://github.com/andredsim), [Min Hao Ling](https://github.com/lingminhao) and [Jonathan Goeke](https://github.com/jonathangoeke) at the Genome Institute of Singapore. If you want to contribute, please leave an issue. Thank you. +This package is developed and maintained by [Andre Sim](https://github.com/andredsim), [Chin Hao Lee](https://github.com/ch99l), [Min Hao Ling](https://github.com/lingminhao), and [Jonathan Goeke](https://github.com/jonathangoeke) at the Genome Institute of Singapore. If you wish to contribute, please leave an issue. Thank you. diff --git a/assets/10x_config/adapter_seq_config.csv b/assets/10x_config/adapter_seq_config.csv new file mode 100644 index 0000000..839572c --- /dev/null +++ b/assets/10x_config/adapter_seq_config.csv @@ -0,0 +1,11 @@ +technology,fwd_primer_f,fwd_primer_r,rev_primer_f,rev_primer_r,TSO_f,TSO_r +10x3v2,CTACACGACGCTCTTCCGATCT,AGATCGGAAGAGCGTCGTGTAG,CCCATGTACTCTGCGTTGATACCACTGCTT,AAGCAGTGGTATCAACGCAGAGTACATGGG,, +10x3v3,CTACACGACGCTCTTCCGATCT,AGATCGGAAGAGCGTCGTGTAG,CCCCTCTGCGTTGATACCACTGCTT,AAGCAGTGGTATCAACGCAGAGGGG,, +10x3v4,CTACACGACGCTCTTCCGATCT,AGATCGGAAGAGCGTCGTGTAG,CCCCTCTGCGTTGATACCACTGCTT,AAGCAGTGGTATCAACGCAGAGGGG,, +10x5v2,CTACACGACGCTCTTCCGATCT,AGATCGGAAGAGCGTCGTGTAG,GTACTCTGCGTTGATACCACTGCTT,AAGCAGTGGTATCAACGCAGAGTAC,TTTCTTATATGGG,CCCATATAAGAAA +10x5v3,CTACACGACGCTCTTCCGATCT,AGATCGGAAGAGCGTCGTGTAG,GTACTCTGCGTTGATACCACTGCTT,AAGCAGTGGTATCAACGCAGAGTAC,TTTCTTATATGGG,CCCATATAAGAAA +visium-v1,CTACACGACGCTCTTCCGATCT,AGATCGGAAGAGCGTCGTGTAG,CCCATGTACTCTGCGTTGATACCACTGCTT,AAGCAGTGGTATCAACGCAGAGTACATGGG,, +visium-v2,CTACACGACGCTCTTCCGATCT,AGATCGGAAGAGCGTCGTGTAG,CCCATGTACTCTGCGTTGATACCACTGCTT,AAGCAGTGGTATCAACGCAGAGTACATGGG,, +visium-v3,CTACACGACGCTCTTCCGATCT,AGATCGGAAGAGCGTCGTGTAG,CCCATGTACTCTGCGTTGATACCACTGCTT,AAGCAGTGGTATCAACGCAGAGTACATGGG,, +visium-v4,CTACACGACGCTCTTCCGATCT,AGATCGGAAGAGCGTCGTGTAG,CCCATGTACTCTGCGTTGATACCACTGCTT,AAGCAGTGGTATCAACGCAGAGTACATGGG,, +visium-v5,CTACACGACGCTCTTCCGATCT,AGATCGGAAGAGCGTCGTGTAG,CCCATGTACTCTGCGTTGATACCACTGCTT,AAGCAGTGGTATCAACGCAGAGTACATGGG,, \ No newline at end of file diff --git a/assets/10x_config/barcode_coordinate_config.csv b/assets/10x_config/barcode_coordinate_config.csv new file mode 100644 index 0000000..5c9085a --- /dev/null +++ b/assets/10x_config/barcode_coordinate_config.csv @@ -0,0 +1,11 @@ +technology,barcode_path,spatial_coordinate_path +10x3v2,737K-august-2016.txt, +10x3v3,3M-february-2018_TRU.txt.gz, +10x3v4,3M-3pgex-may-2023_TRU.txt.gz, +10x5v2,737K-august-2016.txt, +10x5v3,3M-5pgex-jan-2023.txt.gz, +visium-v1,visium-v1.txt,visium-v1_coordinates.txt +visium-v2,visium-v2.txt,visium-v2_coordinates.txt +visium-v3,visium-v3.txt,visium-v3_coordinates.txt +visium-v4,visium-v4.txt,visium-v4_coordinates.txt +visium-v5,visium-v5.txt,visium-v5_coordinates.txt \ No newline at end of file diff --git a/assets/10x_config/flank_seq_config.csv b/assets/10x_config/flank_seq_config.csv new file mode 100644 index 0000000..0b69b18 --- /dev/null +++ b/assets/10x_config/flank_seq_config.csv @@ -0,0 +1,11 @@ +technology,left_flank,barcode,umi,right_flank +10x3v2,CTACACGACGCTCTTCCGATCT,????????????????,??????????,TTTTTTTTTTTTTTTTTTTTTTTTTTTTTT +10x3v3,CTACACGACGCTCTTCCGATCT,????????????????,????????????,TTTTTTTTTTTTTTTTTTTTTTTTTTTTTT +10x3v4,CTACACGACGCTCTTCCGATCT,????????????????,????????????,TTTTTTTTTTTTTTTTTTTTTTTTTTTTTT +10x5v2,CTACACGACGCTCTTCCGATCT,????????????????,??????????,TTTCTTATATGGG +10x5v3,CTACACGACGCTCTTCCGATCT,????????????????,????????????,TTTCTTATATGGG +visium-v1,CTACACGACGCTCTTCCGATCT,????????????????,????????????,TTTTTTTTTTTTTTTTTTTTTTTTTTTTTT +visium-v2,CTACACGACGCTCTTCCGATCT,????????????????,????????????,TTTTTTTTTTTTTTTTTTTTTTTTTTTTTT +visium-v3,CTACACGACGCTCTTCCGATCT,????????????????,????????????,TTTTTTTTTTTTTTTTTTTTTTTTTTTTTT +visium-v4,CTACACGACGCTCTTCCGATCT,????????????????,????????????,TTTTTTTTTTTTTTTTTTTTTTTTTTTTTT +visium-v5,CTACACGACGCTCTTCCGATCT,????????????????,????????????,TTTTTTTTTTTTTTTTTTTTTTTTTTTTTT \ No newline at end of file diff --git a/bin/reverse_complement_fastq.py b/bin/reverse_complement_fastq.py new file mode 100755 index 0000000..347c0fb --- /dev/null +++ b/bin/reverse_complement_fastq.py @@ -0,0 +1,116 @@ +#!/usr/bin/env python3 +import argparse +import sys + +DNA_COMPLEMENT = str.maketrans("ACGTNacgtn", "TGCANtgcan") + +def parse_args(): + parser = argparse.ArgumentParser(description = "Reverse Complementing FASTQ files generated by Flexiplex") + parser.add_argument("-i", "--input", default = '-', help = "Input FASTQ file") + parser.add_argument("-o", "--output", default = '-', help = "Output FASTQ file") + args = parser.parse_args() + + return args + +def modify_read_id(id): + """ + Reverses strand direction tag in the Read ID. Example: GGAATCTCAAGCGCAA_TGGTCTTATTAA#9862034a-576a-44ad-bab9-30e8e9927dde_+1of1 + will be modified to GGAATCTCAAGCGCAA_TGGTCTTATTAA#9862034a-576a-44ad-bab9-30e8e9927dde_-1of1 + + Args: + id (str): Read ID + + Returns: + str: Modified Read ID + """ + rev_dict = {'+': '-', '-': '+'} + id_list = id.split('_') + + # Exception handling in the event of unusual Flexiplex Read ID format + try: + strand_dir = id_list[-1][0] + id_list[-1] = rev_dict.get(strand_dir, strand_dir) + id_list[-1][1:] + except IndexError: + pass + + return "_".join(id_list) + +def modify_read_description(header): + """ + Reverses strand direction tag in the Description Header. Example: GGAATCTCAAGCGCAA_TGGTCTTATTAA#9862034a-576a-44ad-bab9-30e8e9927dde_+1of1 CB:Z:GGAATCTCAAGCGCAA UB:Z:TGGTCTTATTAA + will be modified to GGAATCTCAAGCGCAA_TGGTCTTATTAA#9862034a-576a-44ad-bab9-30e8e9927dde_-1of1 CB:Z:GGAATCTCAAGCGCAA UB:Z:TGGTCTTATTAA + + Args: + header (str): Description header + + Returns: + str: Modified description header + """ + + header_list = header.split() + original_read_id = header_list[0] + modified_read_id = modify_read_id(original_read_id) + + # Preserves trailing tags like CB:Z: / UB:Z: + return modified_read_id + header[len(original_read_id):] + +def reverse_complement_seq(seq): + """ + Reverse complements a DNA sequence + + Args: + seq (str): DNA sequence + + Returns: + str: Sequence of the reverse complement + """ + return seq[::-1].translate(DNA_COMPLEMENT) + +def reverse_phred_scores(phred_scores): + """ + Reverses Phred Quality Sequence + + Args: + phred_scores (str): Phred quality score of the forward strand + + Returns: + str: Phred quality score of the reverse complement + """ + return phred_scores[::-1] + +if __name__ == "__main__": + # Parse arguments + args = parse_args() + f_in = sys.stdin if args.input == '-' else open(args.input, 'r') + f_out = sys.stdout if args.output == '-' else open(args.output, 'w') + + # Track number of reads processed + reads_processed = 0 + + while True: + # Retrieve information for each read (stored in 4 lines) + header = f_in.readline().rstrip() + # Stop once header is empty + if not header: + break + + dna_seq = f_in.readline().rstrip() + f_in.readline() # Read separator line but do not store it + phred_seq = f_in.readline().rstrip() + + # Get header, DNA sequence and Phred sequence for reverse complement + rc_header = modify_read_description(header) + rc_dna_seq = reverse_complement_seq(dna_seq) + rc_phred_seq = reverse_phred_scores(phred_seq) + + # Write output + f_out.write(f"{rc_header}\n{rc_dna_seq}\n+\n{rc_phred_seq}\n") + + # Increment read counter + reads_processed += 1 + if reads_processed % 1000000 == 0: + sys.stderr.write(f"\rProcessed {reads_processed/1000000} million reads") + + # Close file handles if not stdin/stdout + if args.input != '-': f_in.close() + if args.output != '-': f_out.close() diff --git a/containers/alignment/Dockerfile b/containers/alignment/Dockerfile new file mode 100644 index 0000000..e916f3d --- /dev/null +++ b/containers/alignment/Dockerfile @@ -0,0 +1,11 @@ +FROM mambaorg/micromamba:git-c0f93d2-amazon2023 + +RUN micromamba install -y -n base \ + -c conda-forge \ + -c bioconda \ + minimap2=2.30 \ + samtools=1.23 \ + procps-ng \ +&& micromamba clean -ay + +ENV PATH=/opt/conda/bin:$PATH \ No newline at end of file diff --git a/containers/preprocess/Dockerfile b/containers/preprocess/Dockerfile new file mode 100644 index 0000000..cc35d5e --- /dev/null +++ b/containers/preprocess/Dockerfile @@ -0,0 +1,13 @@ +FROM mambaorg/micromamba:git-c0f93d2-amazon2023 + +RUN micromamba install -y -n base \ + -c conda-forge \ + -c bioconda \ + chopper=0.12.0 \ + flexiplex=1.02.5 \ + cutadapt=5.2 \ + pigz=2.8 \ + procps-ng \ +&& micromamba clean -ay + +ENV PATH=/opt/conda/bin:$PATH \ No newline at end of file diff --git a/containers/r/Dockerfile b/containers/r/Dockerfile new file mode 100644 index 0000000..5ed83b1 --- /dev/null +++ b/containers/r/Dockerfile @@ -0,0 +1,10 @@ +FROM rocker/r-base:4.4.1 + +# install system dependencies +RUN apt-get update && apt-get install -y \ + libcurl4-openssl-dev \ + procps && rm -rf /var/lib/apt/lists/* + +# install Seurat Object (v5.3.0), Seurat (v5.4.0), and Bambu +RUN R -e "install.packages(c('pak', 'devtools', 'BiocManager'), repos='https://cloud.r-project.org')" +RUN R -e "pak::pkg_install(c('SeuratObject@5.3.0', 'Seurat@5.4.0', 'GoekeLab/bambu@devel_pre_v4'))" \ No newline at end of file diff --git a/main.nf b/main.nf index 75a6359..ba69be1 100644 --- a/main.nf +++ b/main.nf @@ -2,601 +2,115 @@ nextflow.enable.dsl=2 -params.chemistry = "custom" //"10x3v3" "10x3v2" "10x5v2" "10x5v3" -params.technology = 'ONT' //"ONT" "PacBio" -params.whitelist = "NULL" -params.bambuPath = "bambu" -params.processByBam = "FALSE" -params.processByChomosome = "TRUE" -params.ncore = 4 -params.spatial = null -params.fusionMode = null - -params.NDR = "NULL" -params.cleanReads = "TRUE" -params.keepChimericReads = "FALSE" -params.deduplicateUMIs = "TRUE" -params.bambuParams = tuple(params.cleanReads, params.keepChimericReads, params.deduplicateUMIs) -params.barcodeMap = "TRUE" -params.clusters = "auto" -params.resolution = 0.8 -params.reads = null -params.bams = null -params.noEM = null - -params.flexiplex_x = 'CTACACGACGCTCTTCCGATCT' //sequence Append flanking sequence to search for -params.flexiplex_b = '????????????????' //sequence Append the barcode pattern to search for -params.flexiplex_u = '????????????' //sequence Append the UMI pattern to search for -params.flexiplex_x2 = 'TTTTTTTTT' //sequence Append flanking sequence to search for -params.flexiplex_e = 1 - -params.jaffal_code_dir = "$projectDir/jaffal" -params.jaffal_ref_dir = null - -params.outdir = "output" - -process flexiplex{ - - publishDir "$params.outdir", mode: 'copy' - container "lingminhao/bambusc:beta1.2" - - cpus params.ncore - maxForks params.ncore - - input: - tuple val(sample), path(fastq), val(chemistry), val(technology), val(whitelist) - - output: - tuple val(sample), path("${sample}_flexiplexfilter_reads.fastq.gz"), val(chemistry), val(technology), emit: fastq - - script: - """ - chem="$chemistry" - if [[ "$chemistry" == 10x3v4 || "$chemistry" == 10x3v3 ]]; then - chem="-x CTACACGACGCTCTTCCGATCT -b ???????????????? -u ???????????? -x TTTTTTTTT" - elif [[ "$chemistry" == 10x3v2 ]]; then - chem="-x CTACACGACGCTCTTCCGATCT -b ???????????????? -u ?????????? -x TTTTTTTTT" - elif [[ "$chemistry" == 10x5v2 ]]; then - chem="-x CTACACGACGCTCTTCCGATCT -b ???????????????? -u ?????????? -x TTTCTTATATGGG" - elif [[ "$chemistry" == 10x5v3 ]]; then - chem="-x CTACACGACGCTCTTCCGATCT -b ???????????????? -u ???????????? -x TTTCTTATATGGG" - fi - - gunzip -c $fastq > reads.fastq - flexiplex -p $params.ncore \$chem -f 0 reads.fastq - if [[ $whitelist == "NULL" ]]; then - python /mnt/software/main.py --outfile my_filtered_barcode_list.txt flexiplex_barcodes_counts.txt - else - gunzip -c $whitelist > whitelist.txt - python /mnt/software/main.py --outfile my_barcode_list.txt flexiplex_barcodes_counts.txt - awk '{print \$1}' whitelist.txt my_barcode_list.txt | sort | uniq -d > my_filtered_barcode_list.txt - fi - flexiplex -p $params.ncore -k my_filtered_barcode_list.txt \$chem -f 8 -e $params.flexiplex_e reads.fastq > ${sample}_flexiplexfilter_reads.fastq - gzip ${sample}_flexiplexfilter_reads.fastq - rm reads.fastq - """ +include { PREPARE_INPUT_STANDARD } from './subworkflows/prepare_input_standard.nf' +include { PREPROCESS_FASTQ } from './modules/preprocess_fastq.nf' +include { ALIGNMENT } from './subworkflows/alignment.nf' +include { BAMBU_CONSTRUCT_READ_CLASS } from './modules/bambu_construct_read_class.nf' +include { BAMBU_PREPARE_ANNOTATION } from './modules/bambu_prepare_annotation.nf' +include { BAMBU } from './modules/bambu.nf' +include { SEURAT_CLUSTERING } from './modules/seurat_clustering.nf' +include { BAMBU_EM } from './modules/bambu_EM.nf' + +def validateParams(params) { + // Required inputs + if (!params.input) + error "params.input is not set — please provide a path to a CSV samplesheet" + if (!params.genome) + error "params.genome is not set — please provide a path to the reference genome FASTA file" + if (!params.annotation) + error "params.annotation is not set — please provide a path to the reference annotation GTF file" + + // Enum checks + if (!params.valid_quantification_modes.contains(params.quantification_mode)) + error "Invalid params.quantification_mode '${params.quantification_mode}' — must be one of: ${params.valid_quantification_modes.join(', ')}" + + if (!params.valid_early_stop_stages.contains(params.early_stop_stage)) + error "Invalid params.early_stop_stage '${params.early_stop_stage}' — must be one of: rds, bam, or null" + + // Numeric range checks + if (params.resolution <= 0) + error "Invalid params.resolution '${params.resolution}' — must be a positive number" + + if (params.ndr != null && (params.ndr < 0 || params.ndr > 1)) + error "Invalid params.ndr '${params.ndr}' — must be a float between 0 and 1" } -process minimap{ - publishDir "$params.outdir", mode: 'copy' - container "lingminhao/bambusc:beta1.2" - - cpus params.ncore - maxForks params.ncore - - input: - tuple val(sample),path(newfastq), val(chemistry), val(technology) - each path(genome) - - output: - tuple val(sample), path ('*.demultiplexed.bam') - - script: - """ - if [[ $technology == PacBio ]]; then - minimap2 -ax splice:hq -t $params.ncore -d ref.mmi $genome - minimap2 -ax splice:hq -t $params.ncore -a ref.mmi $newfastq > demultiplexed.sam - - else - minimap2 -ax splice -k14 -t $params.ncore -d ref.mmi $genome - minimap2 -ax splice -k14 -t $params.ncore -a ref.mmi $newfastq > demultiplexed.sam - fi - - samtools sort -@ $params.ncore demultiplexed.sam -o ${sample}.demultiplexed.bam - samtools index -@ $params.ncore ${sample}.demultiplexed.bam - - rm demultiplexed.sam - rm ref.mmi - """ -} - -process bambu{ - publishDir "$params.outdir", mode: 'copy' - container "lingminhao/bambusc:beta1.2" - - cpus params.ncore - maxForks 1 - - input: - val(id) - val(bam) - path(genome) - path(annotation) - val(bambuPath) - tuple val(cleanReads), val(keepChimericReads), val(deduplicateUMIs) - val(NDR) - val(barcode_map) - val(whitelist) - val(clusters) - val(resolution) - - - output: - tuple val ('combined'), path ('*readClassFile.rds'), path ('*quantData.rds') - path ('*extended_annotations.rds') - path ('*.gtf') - path ('*.mtx') - path ('*.tsv') - path ('*_clusters.rds'), emit: clusters - - script: - """ - #!/usr/bin/env Rscript - #.libPaths("/usr/local/lib/R/site-library") - - - - samples = "$bam" - samples = gsub("[][]","", gsub(' ','', samples)) - samples = unlist(strsplit(samples, ',')) - - - - ids <- "$id" - ids <- gsub("[][]","", gsub(' ','', ids)) - ids <- unlist(strsplit(ids, ',')) - runName <- ids - if(length(ids)>1) runName <- "combined" - - if(file.exists("$barcode_map")){ - x = gsub("[][]","",gsub(' ','', "$barcode_map")) - barcode_maps = unlist(strsplit(x, ',')) - } else { - barcode_maps = TRUE - } - - library(devtools) - if("$bambuPath" == "bambu") { - load_all("/mnt/software/bambu") - } else { - load_all("$bambuPath") - } - - spatial = "$whitelist" - if(spatial == "FALSE"){spatial = NULL} - - annotations <- prepareAnnotations("$annotation") - - # Transcript discovery and generate readGrgList for each cell - - readClassFile = bambu(reads = samples, annotations = annotations, genome = "$genome", - ncore = $params.ncore, discovery = FALSE, quant = FALSE, demultiplexed = barcode_maps, - verbose = FALSE, assignDist = FALSE, processByChromosome = as.logical("$params.processByChomosome"), - processByBam = as.logical("$params.processByBam"), yieldSize = 10000000, - sampleNames = ids, cleanReads = as.logical("$cleanReads"), dedupUMI = as.logical("$deduplicateUMIs")) - if(class(readClassFile[[1]])=="character"){ - readClassFile <- lapply(readClassFile, function(eachfile) readRDS(eachfile)) # if rds is provided, combine into one list file and save it - } - saveRDS(readClassFile, paste0(runName, "_readClassFile.rds")) # to align with original bambu, readClassFile should always be of length 1 - if(isFALSE($NDR)){ - extendedAnno = bambu(reads = readClassFile, annotations = annotations, genome = "$genome", ncore = $params.ncore, discovery = TRUE, quant = FALSE, demultiplexed = TRUE, verbose = FALSE, assignDist = FALSE) - - } else{ - extendedAnno = bambu(reads = readClassFile, annotations = annotations, genome = "$genome", ncore = $params.ncore, discovery = TRUE, quant = FALSE, demultiplexed = TRUE, verbose = FALSE, assignDist = FALSE, NDR = $NDR) - - } - saveRDS(extendedAnno, paste0(runName, "_extended_annotations.rds")) - rm(annotations) - se = bambu(reads = readClassFile, annotations = extendedAnno, genome = "$genome", ncore = $params.ncore, discovery = FALSE, quant = FALSE, demultiplexed = TRUE, verbose = FALSE, opt.em = list(degradationBias = FALSE), assignDist = TRUE, spatial = spatial) - saveRDS(se, paste0(runName, "_quantData.rds")) - for(se.x in se){ - if(length(metadata(se.x)[['sampleNames']]) == 1){ - writeBambuOutput(se.x, '.', prefix = metadata(se.x)\$sampleNames) - } else{ - writeBambuOutput(se.x, '.', prefix = "combined_") +workflow { + validateParams(params) + + def ndr = params.ndr ?: 'NULL' + def run_read_class_construction = params.early_stop_stage != 'bam' + def run_bambu_discovery = params.early_stop_stage == null + def run_clustering = params.quantification_mode == 'EM_clusters' + def run_bambu_em = run_bambu_discovery && params.quantification_mode != 'no_quant' + + // load reference files + ch_genome = Channel.value(file(params.genome, checkIfExists: true)) + ch_annotation = Channel.value(file(params.annotation, checkIfExists: true)) + + // load config files + ch_barcode_coordinate_config = file("${projectDir}/assets/10x_config/barcode_coordinate_config.csv", checkIfExists: true) + ch_adapter_seq_config = file("${projectDir}/assets/10x_config/adapter_seq_config.csv", checkIfExists: true) + ch_flank_seq_config = file("${projectDir}/assets/10x_config/flank_seq_config.csv", checkIfExists: true) + + // parsing samplesheet csv file + ch_input = Channel.fromPath(params.input, checkIfExists: true) + .ifEmpty { error "Cannot find samplesheet file: ${params.input}" } + .map { file -> + if (file.extension != "csv") { + error "Invalid samplesheet. Must be a CSV file." } - + return file } - #writeBambuOutput(do.call(cbind, se), '.') - #write(runName, "runName.txt") - #if no clustering provided, automatically cluster - path <- Sys.getenv("PATH") |> strsplit(":") - bin_path <- tail(path[[1]], n=1) - if("$clusters" == "auto"){ - clusters = list() - cellMixs = list() - source(file.path(bin_path,"/utilityFunctions.R")) - for(quantData in se){ - quantData.gene = transcriptToGeneExpression(quantData) - for(sample in unique(colData(quantData)\$sampleName)){ - i = which(colData(quantData)\$sampleName == sample) - counts = assays(quantData.gene)\$counts[,i] - cellMix = clusterCells(counts, resolution = $resolution) - x = setNames(names(cellMix@active.ident), cellMix@active.ident) - names(x) = paste0(sample,"_",names(x)) - clusters = c(clusters, splitAsList(unname(x), names(x))) - cellMixs = c(cellMixs, cellMix) - } + // split CSV rows, validate no mixing of visium-hd with other samples, then branch by technology + ch_input.splitCsv(header:true, sep:',') + .toList() + .map { rows -> + def has_visium_hd = rows.any { it.containsKey('technology') && it.technology == 'visium-hd' } + if (has_visium_hd && rows.size() > 1) + error "Visium HD samples cannot be mixed with other samples" + rows } - saveRDS(cellMixs, paste0(runName, "_cellMixs.rds")) - } - if("$clusters" == "none"){ - clusters = NULL - } - saveRDS(clusters, paste0(runName, "_clusters.rds")) - """ -} - -process bambu_EM{ - - publishDir "$params.outdir", mode: 'copy' - container "lingminhao/bambusc:beta1.2" - - cpus params.ncore - maxForks 1 - - input: - tuple val(sample),path(readClassFile), path(quantData) - path(extendedAnno) - path(gtf) - path(counts) - path(metadata) - path(clusters) - path(genome) - val(bambuPath) - val(clusters) - - output: - path ('*.rds') - path ('*.mtx') - path ('*.tsv') - - script: - """ - #!/usr/bin/env Rscript - #.libPaths("/usr/local/lib/R/site-library") - library(devtools) - if("$bambuPath" == "bambu") { - load_all("/mnt/software/bambu") - } else { - load_all("$bambuPath") - } - if(".txt" %in% "$sample"){runName = readLines("$sample") - } else{runName = "$sample"} - - extendedAnno <- readRDS("$extendedAnno") - quantDatas = readRDS("$quantData") - clusters = readRDS("$clusters") - print(clusters) - degBias = TRUE - if(is.null(clusters)){degBias = FALSE} - se = bambu( reads = "$readClassFile", - annotations = extendedAnno, - genome = "$genome", - quantData = quantDatas, - assignDist = FALSE, - ncore = $params.ncore, - discovery = FALSE, - quant = TRUE, - demultiplexed = TRUE, - verbose = FALSE, - opt.em = list(degradationBias = degBias), - clusters = clusters) - saveRDS(se, paste0(runName, "_se.rds")) - writeBambuOutput(se, path = ".", prefix = paste0(runName, "_EM_"),outputExtendedAnno = FALSE, - outputAll = FALSE, outputBambuModels = FALSE, outputNovelOnly = FALSE) - """ - -} - -process fusion_mode_JAFFAL{ - echo true - publishDir "$params.outdir", mode: 'copy' - container "quay.io/biocontainers/jaffa:2.3--hdfd78af_0" - - input: - path(fastq) - path(jaffal_ref_dir) - path(jaffal_code_dir) - - output: - path('jaffa_results.csv') - - script: - """ - - bpipe run -p refBase=$jaffal_ref_dir -p codeBase=$jaffal_code_dir $jaffal_code_dir/JAFFAL.groovy $fastq - - """ -} - -process fusion_mode_extract{ - publishDir "$params.outdir", mode: 'copy' - container "lingminhao/bambusc:beta1.2" - - input: - path(jaffa_results) - path(bam) - path(genome) - path(annotation) - path(jaffal_ref_dir) - - output: - path('fusionGene.fasta') - path('sample1_fusion.bam') - path('fusion.gtf') - - script: - """ - fusion_detection.R $genome $annotation $jaffa_results - - samtools view -bhL fusion.bed $bam | samtools fastq - > sample1_fusion.fastq - minimap2 -ax splice -G2200k -N 5 --sam-hit-only -t $params.ncore fusionGene.fasta sample1_fusion.fastq | samtools sort -O bam -o sample1_fusion.bam - - samtools index sample1_fusion.bam - """ -} - -process fusion_mode_bambu{ - publishDir "$params.outdir", mode: 'copy' - container "lingminhao/bambusc:beta1.2" - - input: - val(id) - path(fusionGeneScaffolds) - path(bam) - path(fusion_gtf) - val(bambuPath) - tuple val(cleanReads), val(keepChimericReads), val(deduplicateUMIs) - - output: - path('*_fusion_readClassFile.rds') - path('*_fusion_extended_annotations_NDR1.rds') - path('*fusion_quantData.rds') - - script: - """ - #!/usr/bin/env Rscript - - library(devtools) - if("$bambuPath" == "bambu") { - load_all("/mnt/software/bambu") - } else { - load_all("$bambuPath") - } - - ids = "$id" - ids = gsub("[][]","", gsub(' ','', ids)) - ids = unlist(strsplit(ids, ',')) - if(length(ids)>1){runName = "combined" - }else{runName = ids} - - annotations <- prepareAnnotations("$fusion_gtf") - - readClassFile = bambu(reads = "$bam", annotations = annotations, genome = "$fusionGeneScaffolds", - fusionMode = TRUE, ncore = $params.ncore, discovery = FALSE, quant = FALSE, - demultiplexed = TRUE, verbose = FALSE, assignDist = FALSE, processByChromosome = as.logical("$params.processByChomosome"), - processByBam = as.logical("$params.processByBam"), yieldSize = 10000000, sampleNames = ids, - cleanReads = as.logical($cleanReads), dedupUMI = as.logical($deduplicateUMIs)) - saveRDS(readClassFile[[1]], paste0(runName, "_fusion_readClassFile.rds")) - - extendedAnno_NDR1 = bambu(reads = readClassFile, annotations = annotations, - genome = "$fusionGeneScaffolds", NDR = 0.999, fusionMode = TRUE, - ncore = $params.ncore, discovery = TRUE, quant = FALSE, demultiplexed = TRUE, - verbose = FALSE, assignDist = FALSE) - saveRDS(extendedAnno_NDR1,paste0("_fusion_extended_annotations_NDR1.rds")) - rm(annotations) - - se = bambu(reads = readClassFile, annotations = extendedAnno_NDR1, - genome = "$fusionGeneScaffolds", ncore = $params.ncore, discovery = FALSE, - quant = FALSE, demultiplexed = TRUE, verbose = FALSE, opt.em = list(degradationBias = FALSE), - assignDist = TRUE) - saveRDS(se, paste0("_fusion_quantData.rds")) - for(se.x in se){ - writeBambuOutput(se.x, '.', prefix = paste0(metadata(se.x)\$sampleNames, "fusion")) - } - """ -} - -process fusion_mode_bambu_EM{ - - publishDir "$params.outdir", mode: 'copy' - container "lingminhao/bambusc:beta1.2" - - cpus params.ncore - maxForks 1 - - input: - path(readClassFile) - path(extendedAnno) - path(quantData) - path(genome) - val(bambuPath) - path(clusters) - - output: - path ('*.rds') - path ('*.mtx') - path ('*.tsv') - - script: - """ - #!/usr/bin/env Rscript - #.libPaths("/usr/local/lib/R/site-library") - library(devtools) - if("$bambuPath" == "bambu") { - load_all("/mnt/software/bambu") - } else { - load_all("$bambuPath") - } - - extendedAnno <- readRDS("$extendedAnno") - quantDatas = readRDS("$quantData") - clusters = readRDS("$clusters") - degBias = TRUE - if(is.null(clusters)){ - degBias = FALSE - } else{ - sampleID = gsub("[AGCT]*\$", "", clusters[[1]][[1]][1], perl = TRUE) - fusionID = paste0(colData(quantDatas[[1]])\$sampleName[1], "_") - clusters[[1]] = gsub(sampleID, fusionID, clusters[[1]]) - } - - se = bambu( reads = "$readClassFile", - annotations = extendedAnno, - genome = "$genome", - quantData = quantDatas, - assignDist = FALSE, - ncore = $params.ncore, - discovery = FALSE, - quant = TRUE, - demultiplexed = TRUE, - verbose = FALSE, - opt.em = list(degradationBias = degBias), - clusters = clusters) - - saveRDS(se, paste0("_fusion_se.rds")) - writeBambuOutput(se, path = ".", prefix = paste0("_fusion_EM_"), outputExtendedAnno = FALSE, - outputAll = FALSE, outputBambuModels = FALSE, outputNovelOnly = FALSE) - """ - -} - -// This is the workflow to execute the process -workflow { - ch_genome = Channel.fromPath(params.genome, checkIfExists: true) - ch_annotation = Channel.fromPath(params.annotation, checkIfExists: true) - - if (params.reads) { - //User can provide either 1 .fastq file or a .csv with .fastq files - fastq = file(params.reads, checkIfExists:true) - if(fastq.getExtension() == "csv") { - //TODO NEED TO CHECK THAT ALL CHEMISTRY AND TECHNOLOGY VALUES ARE VALID - //TODO NEED TO INCLUDE WHITELIST - - readsChannel = Channel.fromPath(params.reads) \ - | splitCsv(header:true, sep:',') \ - | map { row-> tuple(row.sample, file(row.fastq), - row.containsKey("chemistry") ? row.chemistry : params.chemistry, - row.containsKey("technology") ? row.technology : params.technology, - row.containsKey("whitelist") ? row.whitelist : params.whitelist, - row.containsKey("barcode_map") ? row.barcode_map : params.barcodeMap, - row.containsKey("clusters") ? row.whitelist : params.clusters) } - flexiplex_out_ch = flexiplex(readsChannel.map{it[0..4]}) - minimap_out_ch = minimap(flexiplex_out_ch, ch_genome) - - whitelists = readsChannel.collect{it[4]} - barcodeMaps = readsChannel.collect{it[5]} - clusters = readsChannel.collect{it[6]} - - barcodeMaps2 = barcodeMaps.map { it == null ? it : params.barcodeMap } - whiteLists2 = whitelists.map { it == null ? it : params.whitelist } - clusters2 = clusters.map { it == null ? it : params.clusters } - } - else { - //if (params.chemistry != "10x3v3"| params.chemistry != "10x3v2" | params.chemistry != "10x5v2"){ exit 1, "--chemistry must be one of (3prime-v3/3prime-v2/5prime-v2)" } - //if (params.technology == false) { exit 1, "--technology must be one of (ONT/PacBio)" } - readsChannel = Channel.fromPath(params.reads) - readsChannel = readsChannel - .map {tuple("Bambu", it, params.chemistry, params.technology, params.whitelist)} - flexiplex_out_ch = flexiplex(readsChannel) - minimap_out_ch = minimap(flexiplex_out_ch, ch_genome) - barcodeMaps2 = params.barcodeMap - whiteLists2 = params.whitelist - clusters2 = params.clusters - - - } - sampleIds = minimap_out_ch.collect{it[0]} - bamsFiles = minimap_out_ch.collect{it[1]} - if (params.fusionMode) { - ch_jaffal_ref_dir = Channel.fromPath(params.jaffal_ref_dir, checkIfExists: true) - ch_jaffal_code_dir = Channel.fromPath(params.jaffal_code_dir, checkIfExists: true) - fusion_mode_JAFFAL_out_ch = fusion_mode_JAFFAL(readsChannel.collect{it[1]}, ch_jaffal_ref_dir, ch_jaffal_code_dir) - fusion_mode_extract_out_ch = fusion_mode_extract(fusion_mode_JAFFAL_out_ch, bamsFiles.flatten(), ch_genome, ch_annotation, "$params.jaffal_ref_dir") - fusion_mode_bambu_out_ch = fusion_mode_bambu(sampleIds, fusion_mode_extract_out_ch, "$params.bambuPath", params.bambuParams) - } - } - else if(params.bams){ //When starting from bam - bam = file(params.bams, checkIfExists:true) - if(bam.getExtension() == "csv") { - bamsChannel = Channel.fromPath(params.bams) \ - | splitCsv(header:true, sep:',') \ - | map { row-> tuple(row.sample, file(row.bam), - row.containsKey("barcode_map") ? row.barcode_map : null, - row.containsKey("spatial_whitelist") ? row.spatial_whitelist : null, - row.containsKey("clusters") ? row.clusters : null)} - barcodeMaps = bamsChannel.collect{it[2]} - whiteLists = bamsChannel.collect{it[3]} - clusters = bamsChannel.collect{it[4]} - - barcodeMaps2 = barcodeMaps.map { it == null ? it : params.barcodeMap } - clusters2 = clusters.map { it == null ? it : params.clusters } - whiteLists2 = whiteLists.map { it == null ? it : params.whitelist } - } - else if(bam.getExtension() == "bam"){ - bamsChannel = Channel.fromPath(params.bams) - bamsChannel = bamsChannel - .map {["Bambu", it]} - - barcodeMaps2 = params.barcodeMap - whiteLists2 = params.whitelist - clusters2 = params.clusters - } - sampleIds = bamsChannel.collect{it[0]} - bamsFiles = bamsChannel.collect{it[1]} - } - else if(params.rds){ - // rds is provided a 1 or multiple files, i.e., 1rds or 1 csv with multiple rds files - rds = file(params.rds, checkIfExists:true) - if(rds.getExtension() == "csv") { - rdsChannel = Channel.fromPath(params.rds) \ - | splitCsv(header:true, sep:',') \ - | map { row-> tuple(row.sample, file(row.rds), - row.containsKey("barcode_map") ? row.barcode_map : null, - row.containsKey("spatial_whitelist") ? row.spatial_whitelist : null, - row.containsKey("clusters") ? row.clusters : null) } - barcodeMaps = rdsChannel.collect{it[2]} - whiteLists = rdsChannel.collect{it[3]} - clusters = rdsChannel.collect{it[4]} - - barcodeMaps2 = barcodeMaps.map { it == null ? it : params.barcodeMap } - clusters2 = clusters.map { it == null ? it : params.clusters } - whiteLists2 = whiteLists.map { it == null ? it : params.whitelist } - } - else if(rds.getExtension() == "rds"){ - rdsChannel = Channel.fromPath(params.rds) - rdsChannel = rdsChannel - .map {["Bambu", it]} - - barcodeMaps2 = params.barcodeMap - whiteLists2 = params.whitelist - clusters2 = params.clusters - } - sampleIds = rdsChannel.collect{it[0]} - bamsFiles = rdsChannel.collect{it[1]} - - } - if(!params.spatial){ - whiteLists2 = "FALSE" - } - bambu_out_ch = bambu(sampleIds, bamsFiles, ch_genome, ch_annotation, "$params.bambuPath", params.bambuParams,"$params.NDR",barcodeMaps2, whiteLists2, clusters2, "$params.resolution") - if(!params.noEM){ - if (params.fusionMode) { - fusion_mode_bambu_EM(fusion_mode_bambu_out_ch, ch_genome, "$params.bambuPath", bambu_out_ch.clusters) - }else{ - bambuEM_out_ch = bambu_EM(bambu_out_ch, ch_genome, "$params.bambuPath", bambu_out_ch.clusters) - } - } -} - + .flatMap { it } + .branch { + visium_hd: it.containsKey('technology') && it.technology == 'visium-hd' + standard: true + }.set { ch_branched } + + PREPARE_INPUT_STANDARD(ch_branched.standard, ch_barcode_coordinate_config) + + // input files are split by type (fastq, bam, rds) + ch_input_fastq = PREPARE_INPUT_STANDARD.out.fastq + ch_input_bam = PREPARE_INPUT_STANDARD.out.bam + ch_input_rds = PREPARE_INPUT_STANDARD.out.rds + + // process fastq samples + ch_preprocess_fastq_in = ch_input_fastq.map { sample, path, meta -> [sample, path, meta, meta.barcode] } // add whitelist path to fastq input tuple + PREPROCESS_FASTQ(ch_preprocess_fastq_in, ch_flank_seq_config, ch_adapter_seq_config) + ALIGNMENT(PREPROCESS_FASTQ.out.fastq, ch_genome, ch_annotation) + + // process bam samples + if (run_read_class_construction) { + ch_bam_files = ALIGNMENT.out.bam.concat(ch_input_bam) // concatenate aligned bam files with input bam files + BAMBU_PREPARE_ANNOTATION(ch_annotation) // prepare annotation once for all samples + BAMBU_CONSTRUCT_READ_CLASS(ch_bam_files, ch_genome, BAMBU_PREPARE_ANNOTATION.out) + } + + // process rds samples + if (run_bambu_discovery) { + ch_rds_files = BAMBU_CONSTRUCT_READ_CLASS.out.rds.concat(ch_input_rds) // concatenate constructed read class rds files with input rds files + // reshape and collect rds file channel + ch_rds_files_collect = ch_rds_files + .map { sample, path, meta -> [sample, path, meta, meta.spatial_metadata] } + .collect(flat:false) + .map { it.transpose() } + BAMBU(ch_rds_files_collect, ch_genome, BAMBU_PREPARE_ANNOTATION.out, ndr) + } + + if (run_bambu_em) { + SEURAT_CLUSTERING(BAMBU.out.quant_data, run_clustering) + ch_rds_files_em = ch_rds_files_collect.map { samples, paths, metas, spatial -> [samples, paths, metas] } // remove spatial metadata from input tuple for EM step + BAMBU_EM(ch_rds_files_em, BAMBU.out.quant_data, BAMBU.out.extended_annotations, SEURAT_CLUSTERING.out.clusters, ch_genome) + } +} \ No newline at end of file diff --git a/modules/bambu.nf b/modules/bambu.nf new file mode 100644 index 0000000..170a05c --- /dev/null +++ b/modules/bambu.nf @@ -0,0 +1,49 @@ +process BAMBU{ + publishDir "$params.output_dir", mode: 'copy', pattern: '*extended_annotations.gtf' + container "ghcr.io/ch99l/bambu-pipe-r:latest" + label "medium_cpu" + label "high_mem" + label "medium" + + input: + tuple val(sample), path(rds_files), val(meta), path(spatial_metadata_files, stageAs: '?/*') + path(genome) + path(bambu_annotation) + val(ndr) + + output: + path ('*quantData.rds'), emit: quant_data + path ('*extended_annotations.rds'), emit: extended_annotations + path ('*extended_annotations.gtf'), emit: extended_annotations_gtf + + script: + """ + #!/usr/bin/env Rscript + #.libPaths("/usr/local/lib/R/site-library") + if ("$params.bambu_path" == "null") { library("bambu") } else { library("devtools"); load_all("$params.bambu_path") } + + ## Transcript discovery and quantification without EM + idNames <- strsplit("${sample.join(',')}", ",")[[1]] + runName = if (length(idNames) == 1) idNames[1] else "combined" + annotation <- readRDS("$bambu_annotation") + readClassFile <- strsplit("${rds_files.join(',')}", ",")[[1]] + sampleData <- strsplit("${spatial_metadata_files.join(',')}", ",")[[1]] + + # Set sampleData to NA/NULL for non-spatial samples + contains_visium_standard <- grepl("visium-v", sampleData) + sampleData[!contains_visium_standard] <- NA + sampleData <- if (all(is.na(sampleData))) NULL else sampleData + + # Transcript discovery + extendedAnno = bambu(reads = readClassFile, annotations = annotation, genome = "$genome", ncore = $task.cpus, + discovery = TRUE, quant = FALSE, demultiplexed = TRUE, verbose = FALSE, assignDist = FALSE, NDR = $ndr) + saveRDS(extendedAnno, paste0(runName, "_extended_annotations.rds")) + writeToGTF(extendedAnno, paste0(runName, "_extended_annotations.gtf")) + + # Quantification without EM + se = bambu(reads = readClassFile, annotations = extendedAnno, genome = "$genome", ncore = $task.cpus, + discovery = FALSE, quant = FALSE, demultiplexed = TRUE, verbose = FALSE, + opt.em = list(degradationBias = FALSE), assignDist = TRUE, sampleData = sampleData) + saveRDS(se, paste0(runName, "_quantData.rds")) + """ +} \ No newline at end of file diff --git a/modules/bambu_EM.nf b/modules/bambu_EM.nf new file mode 100644 index 0000000..8f1df55 --- /dev/null +++ b/modules/bambu_EM.nf @@ -0,0 +1,40 @@ +process BAMBU_EM{ + publishDir "$params.output_dir", mode: 'copy' + container "ghcr.io/ch99l/bambu-pipe-r:latest" + label "medium_cpu" + label "high_mem" + label "medium" + + input: + tuple val(sample), path(rds_files), val(meta) + path(quant_data) + path(extended_annotation) + path(clusters) + path(genome) + + output: + path ('*_se.rds') + + script: + """ + #!/usr/bin/env Rscript + #.libPaths("/usr/local/lib/R/site-library") + if ("$params.bambu_path" == "null") { library("bambu") } else { library("devtools"); load_all("$params.bambu_path") } + + idNames <- strsplit("${sample.join(',')}", ",")[[1]] + runName = if (length(idNames) == 1) idNames[1] else "combined" + readClassFile <- strsplit("${rds_files.join(',')}", ",")[[1]] + extendedAnno <- readRDS("$extended_annotation") + quantDatas = readRDS("$quant_data") + clusters = readRDS("$clusters") + print(clusters) + degBias = TRUE + if(is.null(clusters)){degBias = FALSE} + + se = bambu(reads = readClassFile, annotations = extendedAnno, genome = "$genome", quantData = quantDatas, + assignDist = FALSE, ncore = $task.cpus, discovery = FALSE, quant = TRUE, demultiplexed = TRUE, + verbose = FALSE, opt.em = list(degradationBias = degBias), clusters = clusters) + saveRDS(se, paste0(runName, "_se.rds")) + # writeBambuOutput(se, path = ".", prefix = paste0(runName, "_EM_"),outputExtendedAnno = FALSE, outputAll = FALSE, outputBambuModels = FALSE, outputNovelOnly = FALSE) + """ +} \ No newline at end of file diff --git a/modules/bambu_construct_read_class.nf b/modules/bambu_construct_read_class.nf new file mode 100644 index 0000000..498d8e2 --- /dev/null +++ b/modules/bambu_construct_read_class.nf @@ -0,0 +1,28 @@ +process BAMBU_CONSTRUCT_READ_CLASS{ + container "ghcr.io/ch99l/bambu-pipe-r:latest" + publishDir "${params.output_dir}/read_class", mode: 'copy' + label "low_cpu" + label "high_mem" + label "medium" + + input: + tuple val(sample), path(bam), val(meta) + path(genome) + path(bambu_annotation) + + output: + tuple val(sample), path("${sample}_readClassFile.rds"), val(meta), emit: rds + + script: + """ + #!/usr/bin/env Rscript + if ("$params.bambu_path" == "null") { library("bambu") } else { library("devtools"); load_all("$params.bambu_path") } + + annotation <- readRDS("$bambu_annotation") + readClassFile = bambu(reads = "$bam", annotations = annotation, genome = "$genome", + ncore = $task.cpus, discovery = FALSE, quant = FALSE, demultiplexed = TRUE, + verbose = FALSE, assignDist = FALSE, processByChromosome = as.logical("$params.process_by_chromosome"), + yieldSize = 10000000, dedupUMI = as.logical("$params.deduplicate_umis")) + saveRDS(readClassFile[[1]], "${sample}_readClassFile.rds") + """ +} \ No newline at end of file diff --git a/modules/bambu_prepare_annotation.nf b/modules/bambu_prepare_annotation.nf new file mode 100644 index 0000000..5356561 --- /dev/null +++ b/modules/bambu_prepare_annotation.nf @@ -0,0 +1,21 @@ +process BAMBU_PREPARE_ANNOTATION{ + container "ghcr.io/ch99l/bambu-pipe-r:latest" + label "low_cpu" + label "low_mem" + label "short" + + input: + path(annotation) + + output: + path("bambu_annotation.rds") + + script: + """ + #!/usr/bin/env Rscript + if ("$params.bambu_path" == "null") { library("bambu") } else { library("devtools"); load_all("$params.bambu_path") } + + annotation <- prepareAnnotations("$annotation") + saveRDS(annotation, "bambu_annotation.rds") + """ +} \ No newline at end of file diff --git a/modules/preprocess_fastq.nf b/modules/preprocess_fastq.nf new file mode 100644 index 0000000..9ab1096 --- /dev/null +++ b/modules/preprocess_fastq.nf @@ -0,0 +1,120 @@ +process PREPROCESS_FASTQ { + container "community.wave.seqera.io/library/chopper_cutadapt_flexiplex_pigz:077c3bc67452482c" + label "medium_cpu" + label "medium_mem" + label "long" + + publishDir "$params.output_dir/intermediate_fastq", + mode: 'symlink', + enabled: params.save_intermediates + + input: + tuple val(sample), path(fastq), val(meta), path(whitelist) + path(flank_seq_config) + path(adapter_seq_config) + + output: + tuple val(sample), path("${sample}_preprocessed_reads.fastq.gz"), val(meta), emit: fastq + path("*_intermediate_*"), optional: true + + script: + """ + #======================================================================================================= + # Helper functions (All functions read from stdin and write to stdout) + #======================================================================================================= + # Decompress input FASTQ using parallel gzip (pigz) for faster processing + decompress() { + if [[ $fastq == *.gz ]]; then + pigz -p $task.cpus -d -c $fastq + else + cat $fastq + fi + } + + # Saves intermediate files, otherwise passes data through without saving to disk (for development and testing purposes) + # Arguments: 1=output file name for intermediate file + save_intermediate() { + local out_file=\$1 + if [[ $params.save_intermediates == "true" ]]; then + tee >(pigz -p $task.cpus -c > \$out_file) + else + cat + fi + } + + # FASTQ quality score filtering with chopper (Optional) + chopper_cmd() { + if [[ $params.qscore_filtering == "true" ]]; then + chopper -q $params.qfilter_threshold -t $task.cpus + else + cat + fi + } + + # Demultiplexing with flexiplex + # Arguments: 1=barcode list file generated by flexiplex-filter + flexiplex_demux() { + local barcode_list=\$1 + if [[ $meta.chemistry == 10x5* ]]; then + flexiplex_f=$params.flexiplex_f_5prime + else + flexiplex_f=$params.flexiplex_f_3prime + fi + + flexiplex -p $task.cpus -k \$barcode_list \$flank_seq -f \$flexiplex_f -e $params.flexiplex_e + } + + # Trims reverse primer with cutadapt + cutadapt_trim() { + cutadapt -a \$rev_primer_f --cores $task.cpus - + } + + # Re-searches all primer and TSO sequences to remove non-standard reads + cutadapt_re_search() { + if [[ $meta.chemistry == 10x5* ]]; then + args="-b \$fwd_primer_f -b \$fwd_primer_r -b \$TSO_f -b \$TSO_r -b \$rev_primer_f -b \$rev_primer_r" + else + args="-b \$fwd_primer_f -b \$fwd_primer_r -b \$rev_primer_f -b \$rev_primer_r" + fi + + cutadapt \$args --action none --discard --cores $task.cpus - + } + + # Reverse complements FASTQ reads to orient them in the transcript direction (for 3' and visium chemistries only) + reverse_complement() { + if [[ $meta.chemistry == 10x5* ]]; then + cat # For 5' kits, reads are already in the transcript direction + else + reverse_complement_fastq.py # For 3' kits, orient reads in transcript direction to improve minimap alignment + fi + + } + + #======================================================================================================= + # Executing preprocessing steps (Pipe stdin/stdout to avoid writing large intermediate files to disk) + #======================================================================================================= + # Chain commands: Decompression -> (Optional) Quality score filtering with chopper -> (Optional) Save intermediate file after quality filtering + decompress | chopper_cmd | save_intermediate "${sample}_intermediate_qfilter.fastq.gz" > ${sample}_chopper_out.fastq + + # Extract chemistry specfic parameters from config files + IFS=',' read -r _ left_flank barcode umi right_flank < <(awk -F',' -v chem=$meta.chemistry '\$1 == chem' $flank_seq_config) + IFS=',' read -r _ fwd_primer_f fwd_primer_r rev_primer_f rev_primer_r TSO_f TSO_r < <(awk -F',' -v chem=$meta.chemistry '\$1 == chem' $adapter_seq_config) + flank_seq="-x \$left_flank -b \$barcode -u \$umi -x \$right_flank" + + # Flexiplex filter (barcode filtering) + flexiplex -p $task.cpus \$flank_seq -f 0 ${sample}_chopper_out.fastq + flexiplex-filter -w $whitelist --outfile my_filtered_barcode_list.txt flexiplex_barcodes_counts.txt + + # Chain commands: Flexiplex demultiplexing -> (Optional) Save intermediate file after flexiplex -> Cutadapt trimming of reverse primer -> \ + # Cutadapt re-search for all primer and TSO sequences to remove non-standard reads -> Reverse complementation of reads for 3' and visium chemistry -> Compression with pigz + cat ${sample}_chopper_out.fastq | + flexiplex_demux my_filtered_barcode_list.txt | + save_intermediate "${sample}_intermediate_flexiplex.fastq.gz" | + cutadapt_trim | + cutadapt_re_search | + reverse_complement | + pigz -p $task.cpus -c > ${sample}_preprocessed_reads.fastq.gz + + rm ${sample}_chopper_out.fastq + """ +} \ No newline at end of file diff --git a/modules/seurat_clustering.nf b/modules/seurat_clustering.nf new file mode 100644 index 0000000..1838424 --- /dev/null +++ b/modules/seurat_clustering.nf @@ -0,0 +1,46 @@ +process SEURAT_CLUSTERING { + container "ghcr.io/ch99l/bambu-pipe-r:latest" + label "medium_cpu" + label "high_mem" + label "medium" + + input: + path(quant_data) + val(run_clustering) + + output: + path ('clusters.rds'), emit: clusters + + script: + """ + #!/usr/bin/env Rscript + library("bambu") + + se = readRDS("$quant_data") + + # Seurat Clustering (if no clustering provided, automatically cluster) + path <- Sys.getenv("PATH") |> strsplit(":") + bin_path <- tail(path[[1]], n=1) + clusters = NULL + if(as.logical("$run_clustering")){ + clusters = list() + cellMixs = list() + source(file.path(bin_path,"/utilityFunctions.R")) + for(quantData in se){ + quantData.gene = transcriptToGeneExpression(quantData) + for(sample in unique(colData(quantData)\$sampleName)){ + i = which(colData(quantData)\$sampleName == sample) + counts = assays(quantData.gene)\$counts[,i] + cellMix = clusterCells(counts, resolution = $params.resolution) + x = setNames(names(cellMix@active.ident), cellMix@active.ident) + names(x) = paste0(sample,"_",names(x)) + clusters = c(clusters, splitAsList(unname(x), names(x))) + cellMixs = c(cellMixs, cellMix) + } + } + saveRDS(cellMixs, "cellMixs.rds") + } + + saveRDS(clusters, "clusters.rds") + """ +} diff --git a/nextflow.config b/nextflow.config index f94bc97..dbb422e 100644 --- a/nextflow.config +++ b/nextflow.config @@ -1,4 +1,89 @@ +params { + // Mandatory input + input = null // Path to samplesheet .csv file + genome = null // Path to .fa or .fasta file + annotation = null // Path to .gtf or .gff file + + // Optional: Output directory + output_dir = "output" // Path to output directory + + /* + Optional: Samplesheet settings (Non Visium HD samples only) + Note: Use this if all samples share the same chemistry/technology + */ + chemistry = null // Examples: "10x3v2", "10x3v3", "10x5v2", "visium-v1" + technology = null // Options: "ONT", "PacBio" + + // Optional: Early termination + early_stop_stage = null // Options: "rds", "bam" + + // Optional: Q-score filtering + qscore_filtering = true // boolean + + // Optional: Bambu parameters + ndr = null // null or float + deduplicate_umis = true // boolean + + // Optional: Quantification mode + quantification_mode = "EM_clusters" // Options: "no_quant", "EM", "EM_clusters" + + // Optional: Seurat clustering + resolution = 0.8 // float + + // Development parameters (DO NOT EDIT) + bambu_path = null + valid_chemistries = ['10x3v2', '10x3v3', '10x3v4', '10x5v2', '10x5v3', 'visium-v1', 'visium-v2', 'visium-v3', 'visium-v4', 'visium-v5'] + valid_technologies = ['ONT', 'PacBio'] + valid_quantification_modes = ['no_quant', 'EM', 'EM_clusters'] + valid_early_stop_stages = ['rds', 'bam', null] + save_intermediates = false + qfilter_threshold = 10 + flexiplex_f_5prime = 8 + flexiplex_f_3prime = 13 + flexiplex_e = 1 + process_by_chromosome = true + fusion_mode = false + jaffal_ref_dir = null + jaffal_code_dir = "$projectDir/jaffal" + cellranger_dir = "/opt/spaceranger-4.0.1/lib/python/cellranger/barcodes" +} + +process { + // Retry strategy: up to 3 attempts, doubling memory and adding CPUs each retry + maxRetries = 3 + errorStrategy = { task.exitStatus in [130, 137, 139, 143] ? 'retry' : 'finish' } + + // CPU Labels (scale up with retries) + withLabel: 'low_cpu' { cpus = { 4 * (1 + task.attempt) } } + withLabel: 'medium_cpu' { cpus = { 16 * task.attempt } } + withLabel: 'high_cpu' { cpus = { Math.min(32 * task.attempt, 128) } } + + // Memory Labels (double each retry) + withLabel: 'low_mem' { memory = { 16.GB * Math.pow(2, task.attempt - 1) } } + withLabel: 'medium_mem' { memory = { 64.GB * Math.pow(2, task.attempt - 1) } } + withLabel: 'high_mem' { memory = { 128.GB * Math.pow(2, task.attempt - 1) } } + + // Time Labels (increase with retries) + withLabel: 'short' { time = { 1.h * task.attempt } } + withLabel: 'medium' { time = { 4.h * task.attempt } } + withLabel: 'long' { time = { 12.h * task.attempt } } + + // CPU, Memory, and Time allocation for Bambu (Modify if necessary, especially when using pipeline for multiple samples) + withName: 'BAMBU' { + cpus = { 16 * task.attempt } + memory = { 128.GB * Math.pow(2, task.attempt - 1) } + time = { 4.h * task.attempt } + } + + withName: 'BAMBU_EM' { + cpus = { 16 * task.attempt } + memory = { 128.GB * Math.pow(2, task.attempt - 1) } + time = { 12.h * task.attempt } // increase time allocation if params.quantification_mode = EM + } +} + profiles { + // Container profiles singularity { singularity.enabled = true singularity.autoMounts = true @@ -8,20 +93,20 @@ profiles { SINGULARITYENV_R_LIBS_USER = "/usr/local/lib/R/site-library" SINGULARITYENV_R_ENVIRON_USER = "NULL" } + docker { docker.enabled = true docker.autoMounts = true singularity.enabled = false - docker.runOptions = '-u $(id -u):$(id -g)' + docker.runOptions = '-u $(id -u):$(id -g)' } -arm { - docker.runOptions = '-u $(id -u):$(id -g) --platform=linux/amd64' - } -} -process { - withName:minimap{ - container = "lingminhao/bambusc:beta1.2" - } -} + arm { + docker.runOptions = '-u $(id -u):$(id -g) --platform=linux/amd64' + } + + hpc { + process.executor = 'slurm' // Examples: 'slurm', 'pbs', 'sge' + } +} \ No newline at end of file diff --git a/output/Bambu.demultiplexed.bam b/output/Bambu.demultiplexed.bam deleted file mode 100644 index 925dcba..0000000 Binary files a/output/Bambu.demultiplexed.bam and /dev/null differ diff --git a/output/Bambu__clusters.rds b/output/Bambu__clusters.rds deleted file mode 100644 index a52773f..0000000 Binary files a/output/Bambu__clusters.rds and /dev/null differ diff --git a/output/Bambu__extended_annotations.rds b/output/Bambu__extended_annotations.rds deleted file mode 100644 index 9daf885..0000000 Binary files a/output/Bambu__extended_annotations.rds and /dev/null differ diff --git a/output/Bambu__quantData.rds b/output/Bambu__quantData.rds deleted file mode 100644 index 2ed6b3b..0000000 Binary files a/output/Bambu__quantData.rds and /dev/null differ diff --git a/output/Bambu__readClassFile.rds b/output/Bambu__readClassFile.rds deleted file mode 100644 index 6a80012..0000000 Binary files a/output/Bambu__readClassFile.rds and /dev/null differ diff --git a/output/combined_EM_CPM_transcript.mtx b/output/combined_EM_CPM_transcript.mtx deleted file mode 100644 index a981d79..0000000 --- a/output/combined_EM_CPM_transcript.mtx +++ /dev/null @@ -1,24 +0,0 @@ -%%MatrixMarket matrix coordinate real general -105 2 22 -3 1 .00422 -5 1 194243.17686 -7 1 73446.58795 -12 1 5000 -13 1 5000 -14 1 5000 -19 1 29223.07372 -20 1 224988.07403 -21 1 34094.88901 -49 1 11366.91997 -62 1 1e-5 -67 1 1e-5 -92 1 .00247 -93 1 12637.27175 -96 1 1e-5 -100 1 5000 -7 2 138655.37047 -12 2 138888.88889 -20 2 233.51842 -30 2 55555.55556 -40 2 305555.55556 -85 2 55555.55556 diff --git a/output/combined_EM_counts_gene.mtx b/output/combined_EM_counts_gene.mtx deleted file mode 100644 index ceaf452..0000000 --- a/output/combined_EM_counts_gene.mtx +++ /dev/null @@ -1,12 +0,0 @@ -%%MatrixMarket matrix coordinate real general -23 2 10 -3 1 3 -6 1 97.00001 -2 2 1 -3 2 8 -6 2 6 -7 2 14 -11 2 2 -13 2 2 -19 2 2 -22 2 1 diff --git a/output/combined_EM_counts_transcript.mtx b/output/combined_EM_counts_transcript.mtx deleted file mode 100644 index 943a284..0000000 --- a/output/combined_EM_counts_transcript.mtx +++ /dev/null @@ -1,19 +0,0 @@ -%%MatrixMarket matrix coordinate real general -105 2 17 -5 1 19.42432 -7 1 7.34466 -12 1 .5 -13 1 .5 -14 1 .5 -19 1 2.92231 -20 1 22.49881 -21 1 3.40949 -49 1 1.13669 -93 1 1.26373 -100 1 .5 -7 2 4.99159 -12 2 5 -20 2 .00841 -30 2 2 -40 2 11 -85 2 2 diff --git a/output/combined_EM_fullLengthCounts_transcript.mtx b/output/combined_EM_fullLengthCounts_transcript.mtx deleted file mode 100644 index 0707c4a..0000000 --- a/output/combined_EM_fullLengthCounts_transcript.mtx +++ /dev/null @@ -1,8 +0,0 @@ -%%MatrixMarket matrix coordinate real general -105 2 6 -5 1 5.72049 -7 1 1.27951 -19 1 2.79243 -20 1 21.4989 -21 1 1 -20 2 .00841 diff --git a/output/combined_EM_incompatibleCounts.mtx b/output/combined_EM_incompatibleCounts.mtx deleted file mode 100644 index faf5f18..0000000 --- a/output/combined_EM_incompatibleCounts.mtx +++ /dev/null @@ -1,10 +0,0 @@ -%%MatrixMarket matrix coordinate integer general -23 2 8 -3 1 39 -4 1 1 -3 2 1 -4 2 3 -7 2 1 -19 2 1 -20 2 2 -22 2 3 diff --git a/output/combined_EM_sampleData.tsv b/output/combined_EM_sampleData.tsv deleted file mode 100644 index 4e53cd0..0000000 --- a/output/combined_EM_sampleData.tsv +++ /dev/null @@ -1,3 +0,0 @@ -id -Bambu_0 -Bambu_1 diff --git a/output/combined_EM_uniqueCounts_transcript.mtx b/output/combined_EM_uniqueCounts_transcript.mtx deleted file mode 100644 index 4a21feb..0000000 --- a/output/combined_EM_uniqueCounts_transcript.mtx +++ /dev/null @@ -1,10 +0,0 @@ -%%MatrixMarket matrix coordinate integer general -105 2 8 -7 1 3 -21 1 2 -49 1 1 -7 2 4 -12 2 4 -30 2 2 -40 2 11 -85 2 2 diff --git a/output/combined_counts_gene.mtx b/output/combined_counts_gene.mtx deleted file mode 100644 index 7c770a2..0000000 --- a/output/combined_counts_gene.mtx +++ /dev/null @@ -1,123 +0,0 @@ -%%MatrixMarket matrix coordinate integer general -23 133 121 -7 2 1 -6 3 1 -6 4 1 -6 6 1 -6 8 1 -22 9 1 -6 10 1 -6 11 1 -6 13 1 -6 14 1 -6 16 1 -6 17 3 -6 18 1 -7 19 2 -6 20 1 -6 21 1 -6 22 1 -6 23 2 -13 24 1 -6 25 1 -6 26 1 -6 27 1 -6 28 1 -6 29 1 -6 31 1 -6 32 1 -11 33 1 -6 34 1 -6 35 1 -6 36 1 -6 37 1 -6 38 1 -6 39 2 -6 41 1 -6 42 1 -11 43 1 -6 44 1 -6 45 1 -3 46 2 -6 46 2 -7 46 1 -3 47 1 -6 48 1 -6 49 1 -7 49 2 -6 50 1 -6 51 1 -3 52 1 -3 53 1 -6 54 3 -6 55 1 -6 56 1 -6 57 1 -3 58 2 -6 58 1 -6 59 1 -7 60 1 -6 61 1 -6 62 1 -6 63 1 -6 65 1 -6 68 1 -6 69 1 -6 71 1 -6 72 1 -6 73 1 -6 74 1 -6 75 1 -6 76 1 -3 78 1 -6 80 1 -6 81 1 -6 82 1 -6 83 1 -6 84 1 -6 85 1 -6 86 1 -2 87 1 -6 88 1 -6 90 2 -7 91 1 -19 92 1 -6 93 1 -6 94 1 -13 95 1 -6 96 1 -3 97 1 -7 97 2 -6 98 1 -6 99 1 -6 100 1 -6 101 1 -6 102 1 -6 103 1 -7 104 1 -6 105 1 -6 107 1 -6 108 1 -6 110 2 -6 112 1 -6 113 1 -6 114 2 -7 114 1 -6 115 1 -7 116 1 -6 117 1 -6 118 1 -3 120 1 -6 120 1 -7 120 1 -3 121 1 -6 121 1 -6 123 1 -6 125 1 -6 126 1 -6 128 1 -6 129 1 -6 130 1 -6 131 1 -19 132 1 -6 133 1 diff --git a/output/combined_counts_transcript.mtx b/output/combined_counts_transcript.mtx deleted file mode 100644 index bb760c7..0000000 --- a/output/combined_counts_transcript.mtx +++ /dev/null @@ -1,26 +0,0 @@ -%%MatrixMarket matrix coordinate integer general -105 133 24 -40 2 1 -49 17 1 -30 24 1 -7 46 1 -12 46 2 -40 46 1 -12 47 1 -40 49 2 -7 54 2 -40 60 1 -85 92 1 -30 95 1 -12 97 1 -40 97 2 -40 104 1 -21 112 1 -21 113 1 -7 114 2 -40 114 1 -40 116 1 -7 120 1 -40 120 1 -7 121 1 -85 132 1 diff --git a/output/combined_extended_annotations_allTranscriptModels.gtf b/output/combined_extended_annotations_allTranscriptModels.gtf deleted file mode 100644 index 7966b33..0000000 --- a/output/combined_extended_annotations_allTranscriptModels.gtf +++ /dev/null @@ -1,1081 +0,0 @@ -9 Bambu transcript 12134 13783 . + . gene_id "ENSG00000236875"; transcript_id "ENST00000421620"; NDR "NA"; txScore ""; txScore.noFit ""; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 12134 12190 . + . gene_id "ENSG00000236875"; transcript_id "ENST00000421620"; exon_number "1"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 12291 12340 . + . gene_id "ENSG00000236875"; transcript_id "ENST00000421620"; exon_number "2"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 12726 12834 . + . gene_id "ENSG00000236875"; transcript_id "ENST00000421620"; exon_number "3"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 13088 13157 . + . gene_id "ENSG00000236875"; transcript_id "ENST00000421620"; exon_number "4"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 13338 13487 . + . gene_id "ENSG00000236875"; transcript_id "ENST00000421620"; exon_number "5"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 13566 13783 . + . gene_id "ENSG00000236875"; transcript_id "ENST00000421620"; exon_number "6"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu transcript 14517 25007 . - . gene_id "ENSG00000181404"; transcript_id "BambuTx1"; NDR "1"; txScore ""; txScore.noFit ""; novelGene "FALSE"; novelTranscript "TRUE"; txClassDescription "compatible"; -9 Bambu exon 14517 14940 . - . gene_id "ENSG00000181404"; transcript_id "BambuTx1"; exon_number "10"; NDR "1"; maxTxScore "-1"; maxTxScore.noFit "-1"; novelGene "FALSE"; novelTranscript "TRUE"; txClassDescription "compatible"; -9 Bambu transcript 14521 29739 . - . gene_id "ENSG00000181404"; transcript_id "ENST00000442898"; NDR "NA"; txScore ""; txScore.noFit ""; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 14521 14940 . - . gene_id "ENSG00000181404"; transcript_id "ENST00000442898"; exon_number "11"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 15081 15149 . - . gene_id "ENSG00000181404"; transcript_id "ENST00000442898"; exon_number "10"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 15081 15149 . - . gene_id "ENSG00000181404"; transcript_id "BambuTx1"; exon_number "9"; NDR "1"; maxTxScore "-1"; maxTxScore.noFit "-1"; novelGene "FALSE"; novelTranscript "TRUE"; txClassDescription "compatible"; -9 Bambu exon 15909 16061 . - . gene_id "ENSG00000181404"; transcript_id "ENST00000442898"; exon_number "9"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 15909 16061 . - . gene_id "ENSG00000181404"; transcript_id "BambuTx1"; exon_number "8"; NDR "1"; maxTxScore "-1"; maxTxScore.noFit "-1"; novelGene "FALSE"; novelTranscript "TRUE"; txClassDescription "compatible"; -9 Bambu transcript 15960 25007 . - . gene_id "ENSG00000181404"; transcript_id "BambuTx2"; NDR "1"; txScore ""; txScore.noFit ""; novelGene "FALSE"; novelTranscript "TRUE"; txClassDescription "compatible"; -9 Bambu exon 15960 16061 . - . gene_id "ENSG00000181404"; transcript_id "BambuTx2"; exon_number "8"; NDR "1"; maxTxScore "-1"; maxTxScore.noFit "-1"; novelGene "FALSE"; novelTranscript "TRUE"; txClassDescription "compatible"; -9 Bambu exon 16718 16876 . - . gene_id "ENSG00000181404"; transcript_id "ENST00000442898"; exon_number "8"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 16718 16876 . - . gene_id "ENSG00000181404"; transcript_id "BambuTx1"; exon_number "7"; NDR "1"; maxTxScore "-1"; maxTxScore.noFit "-1"; novelGene "FALSE"; novelTranscript "TRUE"; txClassDescription "compatible"; -9 Bambu exon 16718 16876 . - . gene_id "ENSG00000181404"; transcript_id "BambuTx2"; exon_number "7"; NDR "1"; maxTxScore "-1"; maxTxScore.noFit "-1"; novelGene "FALSE"; novelTranscript "TRUE"; txClassDescription "compatible"; -9 Bambu transcript 16836 25007 . - . gene_id "ENSG00000181404"; transcript_id "BambuTx3"; NDR "1"; txScore ""; txScore.noFit ""; novelGene "FALSE"; novelTranscript "TRUE"; txClassDescription "compatible"; -9 Bambu exon 16836 16876 . - . gene_id "ENSG00000181404"; transcript_id "BambuTx3"; exon_number "7"; NDR "1"; maxTxScore "-1"; maxTxScore.noFit "-1"; novelGene "FALSE"; novelTranscript "TRUE"; txClassDescription "compatible"; -9 Bambu exon 16965 17166 . - . gene_id "ENSG00000181404"; transcript_id "ENST00000442898"; exon_number "7"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 16965 17166 . - . gene_id "ENSG00000181404"; transcript_id "BambuTx1"; exon_number "6"; NDR "1"; maxTxScore "-1"; maxTxScore.noFit "-1"; novelGene "FALSE"; novelTranscript "TRUE"; txClassDescription "compatible"; -9 Bambu exon 16965 17166 . - . gene_id "ENSG00000181404"; transcript_id "BambuTx2"; exon_number "6"; NDR "1"; maxTxScore "-1"; maxTxScore.noFit "-1"; novelGene "FALSE"; novelTranscript "TRUE"; txClassDescription "compatible"; -9 Bambu exon 16965 17166 . - . gene_id "ENSG00000181404"; transcript_id "BambuTx3"; exon_number "6"; NDR "1"; maxTxScore "-1"; maxTxScore.noFit "-1"; novelGene "FALSE"; novelTranscript "TRUE"; txClassDescription "compatible"; -9 Bambu exon 17344 17479 . - . gene_id "ENSG00000181404"; transcript_id "ENST00000442898"; exon_number "6"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 17344 17479 . - . gene_id "ENSG00000181404"; transcript_id "BambuTx1"; exon_number "5"; NDR "1"; maxTxScore "-1"; maxTxScore.noFit "-1"; novelGene "FALSE"; novelTranscript "TRUE"; txClassDescription "compatible"; -9 Bambu exon 17344 17479 . - . gene_id "ENSG00000181404"; transcript_id "BambuTx2"; exon_number "5"; NDR "1"; maxTxScore "-1"; maxTxScore.noFit "-1"; novelGene "FALSE"; novelTranscript "TRUE"; txClassDescription "compatible"; -9 Bambu exon 17344 17479 . - . gene_id "ENSG00000181404"; transcript_id "BambuTx3"; exon_number "5"; NDR "1"; maxTxScore "-1"; maxTxScore.noFit "-1"; novelGene "FALSE"; novelTranscript "TRUE"; txClassDescription "compatible"; -9 Bambu transcript 17426 25007 . - . gene_id "ENSG00000181404"; transcript_id "BambuTx4"; NDR "1"; txScore ""; txScore.noFit ""; novelGene "FALSE"; novelTranscript "TRUE"; txClassDescription "compatible"; -9 Bambu exon 17426 17479 . - . gene_id "ENSG00000181404"; transcript_id "BambuTx4"; exon_number "5"; NDR "1"; maxTxScore "-1"; maxTxScore.noFit "-1"; novelGene "FALSE"; novelTranscript "TRUE"; txClassDescription "compatible"; -9 Bambu exon 17719 17855 . - . gene_id "ENSG00000181404"; transcript_id "ENST00000442898"; exon_number "5"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 17719 17855 . - . gene_id "ENSG00000181404"; transcript_id "BambuTx1"; exon_number "4"; NDR "1"; maxTxScore "-1"; maxTxScore.noFit "-1"; novelGene "FALSE"; novelTranscript "TRUE"; txClassDescription "compatible"; -9 Bambu exon 17719 17855 . - . gene_id "ENSG00000181404"; transcript_id "BambuTx2"; exon_number "4"; NDR "1"; maxTxScore "-1"; maxTxScore.noFit "-1"; novelGene "FALSE"; novelTranscript "TRUE"; txClassDescription "compatible"; -9 Bambu exon 17719 17855 . - . gene_id "ENSG00000181404"; transcript_id "BambuTx3"; exon_number "4"; NDR "1"; maxTxScore "-1"; maxTxScore.noFit "-1"; novelGene "FALSE"; novelTranscript "TRUE"; txClassDescription "compatible"; -9 Bambu exon 17719 17855 . - . gene_id "ENSG00000181404"; transcript_id "BambuTx4"; exon_number "4"; NDR "1"; maxTxScore "-1"; maxTxScore.noFit "-1"; novelGene "FALSE"; novelTranscript "TRUE"; txClassDescription "compatible"; -9 Bambu exon 18028 18174 . - . gene_id "ENSG00000181404"; transcript_id "ENST00000442898"; exon_number "4"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 18028 18174 . - . gene_id "ENSG00000181404"; transcript_id "BambuTx1"; exon_number "3"; NDR "1"; maxTxScore "-1"; maxTxScore.noFit "-1"; novelGene "FALSE"; novelTranscript "TRUE"; txClassDescription "compatible"; -9 Bambu exon 18028 18174 . - . gene_id "ENSG00000181404"; transcript_id "BambuTx2"; exon_number "3"; NDR "1"; maxTxScore "-1"; maxTxScore.noFit "-1"; novelGene "FALSE"; novelTranscript "TRUE"; txClassDescription "compatible"; -9 Bambu exon 18028 18174 . - . gene_id "ENSG00000181404"; transcript_id "BambuTx3"; exon_number "3"; NDR "1"; maxTxScore "-1"; maxTxScore.noFit "-1"; novelGene "FALSE"; novelTranscript "TRUE"; txClassDescription "compatible"; -9 Bambu exon 18028 18174 . - . gene_id "ENSG00000181404"; transcript_id "BambuTx4"; exon_number "3"; NDR "1"; maxTxScore "-1"; maxTxScore.noFit "-1"; novelGene "FALSE"; novelTranscript "TRUE"; txClassDescription "compatible"; -9 Bambu exon 18381 18492 . - . gene_id "ENSG00000181404"; transcript_id "ENST00000442898"; exon_number "3"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 18381 18492 . - . gene_id "ENSG00000181404"; transcript_id "BambuTx1"; exon_number "2"; NDR "1"; maxTxScore "-1"; maxTxScore.noFit "-1"; novelGene "FALSE"; novelTranscript "TRUE"; txClassDescription "compatible"; -9 Bambu exon 18381 18492 . - . gene_id "ENSG00000181404"; transcript_id "BambuTx2"; exon_number "2"; NDR "1"; maxTxScore "-1"; maxTxScore.noFit "-1"; novelGene "FALSE"; novelTranscript "TRUE"; txClassDescription "compatible"; -9 Bambu exon 18381 18492 . - . gene_id "ENSG00000181404"; transcript_id "BambuTx3"; exon_number "2"; NDR "1"; maxTxScore "-1"; maxTxScore.noFit "-1"; novelGene "FALSE"; novelTranscript "TRUE"; txClassDescription "compatible"; -9 Bambu exon 18381 18492 . - . gene_id "ENSG00000181404"; transcript_id "BambuTx4"; exon_number "2"; NDR "1"; maxTxScore "-1"; maxTxScore.noFit "-1"; novelGene "FALSE"; novelTranscript "TRUE"; txClassDescription "compatible"; -9 Bambu exon 24851 25004 . - . gene_id "ENSG00000181404"; transcript_id "ENST00000442898"; exon_number "2"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 24851 25007 . - . gene_id "ENSG00000181404"; transcript_id "BambuTx1"; exon_number "1"; NDR "1"; maxTxScore "-1"; maxTxScore.noFit "-1"; novelGene "FALSE"; novelTranscript "TRUE"; txClassDescription "compatible"; -9 Bambu exon 24851 25007 . - . gene_id "ENSG00000181404"; transcript_id "BambuTx2"; exon_number "1"; NDR "1"; maxTxScore "-1"; maxTxScore.noFit "-1"; novelGene "FALSE"; novelTranscript "TRUE"; txClassDescription "compatible"; -9 Bambu exon 24851 25007 . - . gene_id "ENSG00000181404"; transcript_id "BambuTx3"; exon_number "1"; NDR "1"; maxTxScore "-1"; maxTxScore.noFit "-1"; novelGene "FALSE"; novelTranscript "TRUE"; txClassDescription "compatible"; -9 Bambu exon 24851 25007 . - . gene_id "ENSG00000181404"; transcript_id "BambuTx4"; exon_number "1"; NDR "1"; maxTxScore "-1"; maxTxScore.noFit "-1"; novelGene "FALSE"; novelTranscript "TRUE"; txClassDescription "compatible"; -9 Bambu transcript 27657 30891 . + . gene_id "ENSG00000227518"; transcript_id "ENST00000422679"; NDR "NA"; txScore ""; txScore.noFit ""; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 27657 30445 . + . gene_id "ENSG00000227518"; transcript_id "ENST00000422679"; exon_number "1"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 29602 29739 . - . gene_id "ENSG00000181404"; transcript_id "ENST00000442898"; exon_number "1"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu transcript 30144 30281 . + . gene_id "ENSG00000283921"; transcript_id "ENST00000408365"; NDR "NA"; txScore ""; txScore.noFit ""; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 30144 30281 . + . gene_id "ENSG00000283921"; transcript_id "ENST00000408365"; exon_number "1"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 30758 30891 . + . gene_id "ENSG00000227518"; transcript_id "ENST00000422679"; exon_number "2"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu transcript 34394 35860 . - . gene_id "ENSG00000218839"; transcript_id "ENST00000449442"; NDR "NA"; txScore ""; txScore.noFit ""; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 34394 34957 . - . gene_id "ENSG00000218839"; transcript_id "ENST00000449442"; exon_number "3"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu transcript 34965 35871 . - . gene_id "ENSG00000218839"; transcript_id "ENST00000305248"; NDR "NA"; txScore ""; txScore.noFit ""; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 34965 35264 . - . gene_id "ENSG00000218839"; transcript_id "ENST00000305248"; exon_number "2"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 35060 35264 . - . gene_id "ENSG00000218839"; transcript_id "ENST00000449442"; exon_number "2"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 35504 35871 . - . gene_id "ENSG00000218839"; transcript_id "ENST00000305248"; exon_number "1"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 35504 35860 . - . gene_id "ENSG00000218839"; transcript_id "ENST00000449442"; exon_number "1"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu transcript 66319 68343 . . . gene_id "unstranded.Gene1"; transcript_id "BambuTx19"; NDR "1"; txScore ""; txScore.noFit ""; novelGene "TRUE"; novelTranscript "TRUE"; txClassDescription "newGene-unspliced"; -9 Bambu exon 66319 68343 . . . gene_id "unstranded.Gene1"; transcript_id "BambuTx19"; exon_number "1"; NDR "1"; maxTxScore "-1"; maxTxScore.noFit "-1"; novelGene "TRUE"; novelTranscript "TRUE"; txClassDescription "newGene-unspliced"; -9 Bambu transcript 72674 87667 . + . gene_id "ENSG00000277631"; transcript_id "ENST00000621255"; NDR "NA"; txScore ""; txScore.noFit ""; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 72674 72816 . + . gene_id "ENSG00000277631"; transcript_id "ENST00000621255"; exon_number "1"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu transcript 72675 75293 . + . gene_id "ENSG00000277631"; transcript_id "ENST00000620326"; NDR "NA"; txScore ""; txScore.noFit ""; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 72675 72816 . + . gene_id "ENSG00000277631"; transcript_id "ENST00000620326"; exon_number "1"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu transcript 72691 88826 . + . gene_id "ENSG00000277631"; transcript_id "ENST00000429980"; NDR "NA"; txScore ""; txScore.noFit ""; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 72691 72816 . + . gene_id "ENSG00000277631"; transcript_id "ENST00000429980"; exon_number "1"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu transcript 72705 75327 . + . gene_id "ENSG00000277631"; transcript_id "ENST00000442069"; NDR "NA"; txScore ""; txScore.noFit ""; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 72705 72816 . + . gene_id "ENSG00000277631"; transcript_id "ENST00000442069"; exon_number "1"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu transcript 72727 87739 . + . gene_id "ENSG00000277631"; transcript_id "ENST00000613372"; NDR "NA"; txScore ""; txScore.noFit ""; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 72727 72816 . + . gene_id "ENSG00000277631"; transcript_id "ENST00000613372"; exon_number "1"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu transcript 74139 87590 . + . gene_id "ENSG00000277631"; transcript_id "ENST00000622412"; NDR "NA"; txScore ""; txScore.noFit ""; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 74139 74205 . + . gene_id "ENSG00000277631"; transcript_id "ENST00000622412"; exon_number "1"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 74149 74205 . + . gene_id "ENSG00000277631"; transcript_id "ENST00000442069"; exon_number "2"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 74882 75327 . + . gene_id "ENSG00000277631"; transcript_id "ENST00000442069"; exon_number "3"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 74882 75293 . + . gene_id "ENSG00000277631"; transcript_id "ENST00000620326"; exon_number "2"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 79345 79537 . + . gene_id "ENSG00000277631"; transcript_id "ENST00000429980"; exon_number "2"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 79345 79537 . + . gene_id "ENSG00000277631"; transcript_id "ENST00000613372"; exon_number "2"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 79345 79537 . + . gene_id "ENSG00000277631"; transcript_id "ENST00000621255"; exon_number "2"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 79345 79537 . + . gene_id "ENSG00000277631"; transcript_id "ENST00000622412"; exon_number "2"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 80651 80807 . + . gene_id "ENSG00000277631"; transcript_id "ENST00000621255"; exon_number "3"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 87284 87739 . + . gene_id "ENSG00000277631"; transcript_id "ENST00000613372"; exon_number "3"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 87284 87667 . + . gene_id "ENSG00000277631"; transcript_id "ENST00000621255"; exon_number "4"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 87284 87590 . + . gene_id "ENSG00000277631"; transcript_id "ENST00000622412"; exon_number "3"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu transcript 87661 88775 . + . gene_id "ENSG00000277631"; transcript_id "ENST00000614900"; NDR "NA"; txScore ""; txScore.noFit ""; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 87661 88195 . + . gene_id "ENSG00000277631"; transcript_id "ENST00000614900"; exon_number "1"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 88742 88826 . + . gene_id "ENSG00000277631"; transcript_id "ENST00000429980"; exon_number "3"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 88742 88775 . + . gene_id "ENSG00000277631"; transcript_id "ENST00000614900"; exon_number "2"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu transcript 100804 102850 . - . gene_id "ENSG00000227917"; transcript_id "ENST00000435421"; NDR "NA"; txScore ""; txScore.noFit ""; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 100804 101304 . - . gene_id "ENSG00000227917"; transcript_id "ENST00000435421"; exon_number "2"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu transcript 100994 102941 . - . gene_id "ENSG00000227917"; transcript_id "ENST00000427318"; NDR "NA"; txScore ""; txScore.noFit ""; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 100994 101304 . - . gene_id "ENSG00000227917"; transcript_id "ENST00000427318"; exon_number "3"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 102473 102541 . - . gene_id "ENSG00000227917"; transcript_id "ENST00000427318"; exon_number "2"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 102740 102941 . - . gene_id "ENSG00000227917"; transcript_id "ENST00000427318"; exon_number "1"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 102740 102850 . - . gene_id "ENSG00000227917"; transcript_id "ENST00000435421"; exon_number "1"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu transcript 112713 113754 . - . gene_id "ENSG00000231808"; transcript_id "ENST00000416242"; NDR "NA"; txScore ""; txScore.noFit ""; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 112713 113067 . - . gene_id "ENSG00000231808"; transcript_id "ENST00000416242"; exon_number "2"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 113694 113754 . - . gene_id "ENSG00000231808"; transcript_id "ENST00000416242"; exon_number "1"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu transcript 116231 118204 . - . gene_id "ENSG00000170122"; transcript_id "ENST00000382500"; NDR "NA"; txScore ""; txScore.noFit ""; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 116231 118204 . - . gene_id "ENSG00000170122"; transcript_id "ENST00000382500"; exon_number "1"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu transcript 121038 179058 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000356521"; NDR "0.790184378623962"; txScore ""; txScore.noFit ""; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 121038 121573 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000356521"; exon_number "15"; NDR "0.790184378623962"; maxTxScore "0.209815621376038"; maxTxScore.noFit "0.209815621376038"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu transcript 121041 179147 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000377400"; NDR "NA"; txScore ""; txScore.noFit ""; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 121041 121573 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000377400"; exon_number "15"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu transcript 121044 172169 . - . gene_id "ENSG00000172785"; transcript_id "BambuTx5"; NDR "1"; txScore ""; txScore.noFit ""; novelGene "FALSE"; novelTranscript "TRUE"; txClassDescription "compatible"; -9 Bambu exon 121044 121573 . - . gene_id "ENSG00000172785"; transcript_id "BambuTx5"; exon_number "11"; NDR "1"; maxTxScore "-1"; maxTxScore.noFit "-1"; novelGene "FALSE"; novelTranscript "TRUE"; txClassDescription "compatible"; -9 Bambu transcript 121045 154798 . - . gene_id "ENSG00000172785"; transcript_id "BambuTx6"; NDR "1"; txScore ""; txScore.noFit ""; novelGene "FALSE"; novelTranscript "TRUE"; txClassDescription "compatible"; -9 Bambu exon 121045 121573 . - . gene_id "ENSG00000172785"; transcript_id "BambuTx6"; exon_number "8"; NDR "1"; maxTxScore "-1"; maxTxScore.noFit "-1"; novelGene "FALSE"; novelTranscript "TRUE"; txClassDescription "compatible"; -9 Bambu transcript 121052 146140 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000475990"; NDR "NA"; txScore ""; txScore.noFit ""; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 121052 123282 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000475990"; exon_number "4"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu transcript 121058 164009 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000619157"; NDR "NA"; txScore ""; txScore.noFit ""; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 121058 121573 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000619157"; exon_number "12"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu transcript 121060 179047 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000314367"; NDR "NA"; txScore ""; txScore.noFit ""; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 121060 121573 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000314367"; exon_number "16"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu transcript 121089 149446 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000475411"; NDR "NA"; txScore ""; txScore.noFit ""; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu transcript 121089 179012 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000612045"; NDR "NA"; txScore ""; txScore.noFit ""; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 121089 122090 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000475411"; exon_number "5"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 121089 121573 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000612045"; exon_number "16"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu transcript 121091 148625 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000611457"; NDR "NA"; txScore ""; txScore.noFit ""; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 121091 121573 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000611457"; exon_number "6"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu transcript 121224 179042 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000465014"; NDR "NA"; txScore ""; txScore.noFit ""; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 121224 121573 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000465014"; exon_number "15"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu transcript 121407 179008 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000613508"; NDR "NA"; txScore ""; txScore.noFit ""; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 121407 121573 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000613508"; exon_number "13"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu transcript 121409 179021 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000382447"; NDR "1"; txScore ""; txScore.noFit ""; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu transcript 121409 179056 . - . gene_id "ENSG00000172785"; transcript_id "BambuTx7"; NDR "1"; txScore ""; txScore.noFit ""; novelGene "FALSE"; novelTranscript "TRUE"; txClassDescription "newJunction"; -9 Bambu exon 121409 121573 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000382447"; exon_number "14"; NDR "1"; maxTxScore "-1"; maxTxScore.noFit "-1"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 121409 121573 . - . gene_id "ENSG00000172785"; transcript_id "BambuTx7"; exon_number "14"; NDR "1"; maxTxScore "-1"; maxTxScore.noFit "-1"; novelGene "FALSE"; novelTranscript "TRUE"; txClassDescription "newJunction"; -9 Bambu transcript 121410 166599 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000487575"; NDR "NA"; txScore ""; txScore.noFit ""; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 121410 121573 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000487575"; exon_number "15"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu transcript 121411 123747 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000464198"; NDR "NA"; txScore ""; txScore.noFit ""; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 121411 121573 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000464198"; exon_number "4"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu transcript 121413 123284 . - . gene_id "ENSG00000172785"; transcript_id "BambuTx8"; NDR "1"; txScore ""; txScore.noFit ""; novelGene "FALSE"; novelTranscript "TRUE"; txClassDescription "compatible"; -9 Bambu exon 121413 121573 . - . gene_id "ENSG00000172785"; transcript_id "BambuTx8"; exon_number "3"; NDR "1"; maxTxScore "-1"; maxTxScore.noFit "-1"; novelGene "FALSE"; novelTranscript "TRUE"; txClassDescription "compatible"; -9 Bambu transcript 121414 179016 . - . gene_id "ENSG00000172785"; transcript_id "BambuTx9"; NDR "1"; txScore ""; txScore.noFit ""; novelGene "FALSE"; novelTranscript "TRUE"; txClassDescription "newWithin"; -9 Bambu exon 121414 121573 . - . gene_id "ENSG00000172785"; transcript_id "BambuTx9"; exon_number "13"; NDR "1"; maxTxScore "-1"; maxTxScore.noFit "-1"; novelGene "FALSE"; novelTranscript "TRUE"; txClassDescription "newWithin"; -9 Bambu transcript 121418 167605 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000495302"; NDR "NA"; txScore ""; txScore.noFit ""; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 121418 121573 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000495302"; exon_number "13"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu transcript 121503 146154 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000462513"; NDR "NA"; txScore ""; txScore.noFit ""; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 121503 121573 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000462513"; exon_number "6"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 121961 122090 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000314367"; exon_number "15"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 121961 122090 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000356521"; exon_number "14"; NDR "0.790184378623962"; maxTxScore "0.209815621376038"; maxTxScore.noFit "0.209815621376038"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 121961 122090 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000377400"; exon_number "14"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 121961 122090 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000382447"; exon_number "13"; NDR "1"; maxTxScore "-1"; maxTxScore.noFit "-1"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 121961 122136 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000462513"; exon_number "5"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 121961 122090 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000464198"; exon_number "3"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 121961 122090 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000465014"; exon_number "14"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 121961 122090 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000487575"; exon_number "14"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 121961 122090 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000495302"; exon_number "12"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 121961 122090 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000611457"; exon_number "5"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 121961 122090 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000612045"; exon_number "15"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 121961 122090 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000613508"; exon_number "12"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 121961 122090 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000619157"; exon_number "11"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 121961 122090 . - . gene_id "ENSG00000172785"; transcript_id "BambuTx5"; exon_number "10"; NDR "1"; maxTxScore "-1"; maxTxScore.noFit "-1"; novelGene "FALSE"; novelTranscript "TRUE"; txClassDescription "compatible"; -9 Bambu exon 121961 122090 . - . gene_id "ENSG00000172785"; transcript_id "BambuTx6"; exon_number "7"; NDR "1"; maxTxScore "-1"; maxTxScore.noFit "-1"; novelGene "FALSE"; novelTranscript "TRUE"; txClassDescription "compatible"; -9 Bambu exon 121961 122090 . - . gene_id "ENSG00000172785"; transcript_id "BambuTx7"; exon_number "13"; NDR "1"; maxTxScore "-1"; maxTxScore.noFit "-1"; novelGene "FALSE"; novelTranscript "TRUE"; txClassDescription "newJunction"; -9 Bambu exon 121961 122090 . - . gene_id "ENSG00000172785"; transcript_id "BambuTx8"; exon_number "2"; NDR "1"; maxTxScore "-1"; maxTxScore.noFit "-1"; novelGene "FALSE"; novelTranscript "TRUE"; txClassDescription "compatible"; -9 Bambu exon 121961 122090 . - . gene_id "ENSG00000172785"; transcript_id "BambuTx9"; exon_number "12"; NDR "1"; maxTxScore "-1"; maxTxScore.noFit "-1"; novelGene "FALSE"; novelTranscript "TRUE"; txClassDescription "newWithin"; -9 Bambu transcript 122691 179052 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000616944"; NDR "NA"; txScore ""; txScore.noFit ""; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 122691 123282 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000616944"; exon_number "14"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu transcript 122843 179016 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000613355"; NDR "NA"; txScore ""; txScore.noFit ""; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 122843 123282 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000613355"; exon_number "13"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 123217 123282 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000314367"; exon_number "14"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 123217 123282 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000356521"; exon_number "13"; NDR "0.790184378623962"; maxTxScore "0.209815621376038"; maxTxScore.noFit "0.209815621376038"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 123217 123282 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000377400"; exon_number "13"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 123217 123282 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000382447"; exon_number "12"; NDR "1"; maxTxScore "-1"; maxTxScore.noFit "-1"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 123217 123282 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000462513"; exon_number "4"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 123217 123282 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000464198"; exon_number "2"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 123217 123282 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000465014"; exon_number "13"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 123217 123282 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000475411"; exon_number "4"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 123217 123282 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000487575"; exon_number "13"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 123217 123282 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000495302"; exon_number "11"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 123217 123282 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000611457"; exon_number "4"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 123217 123282 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000612045"; exon_number "14"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 123217 123282 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000613508"; exon_number "11"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 123217 123282 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000619157"; exon_number "10"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 123217 123282 . - . gene_id "ENSG00000172785"; transcript_id "BambuTx5"; exon_number "9"; NDR "1"; maxTxScore "-1"; maxTxScore.noFit "-1"; novelGene "FALSE"; novelTranscript "TRUE"; txClassDescription "compatible"; -9 Bambu exon 123217 123282 . - . gene_id "ENSG00000172785"; transcript_id "BambuTx6"; exon_number "6"; NDR "1"; maxTxScore "-1"; maxTxScore.noFit "-1"; novelGene "FALSE"; novelTranscript "TRUE"; txClassDescription "compatible"; -9 Bambu exon 123217 123282 . - . gene_id "ENSG00000172785"; transcript_id "BambuTx7"; exon_number "12"; NDR "1"; maxTxScore "-1"; maxTxScore.noFit "-1"; novelGene "FALSE"; novelTranscript "TRUE"; txClassDescription "newJunction"; -9 Bambu exon 123217 123284 . - . gene_id "ENSG00000172785"; transcript_id "BambuTx8"; exon_number "1"; NDR "1"; maxTxScore "-1"; maxTxScore.noFit "-1"; novelGene "FALSE"; novelTranscript "TRUE"; txClassDescription "compatible"; -9 Bambu exon 123217 123282 . - . gene_id "ENSG00000172785"; transcript_id "BambuTx9"; exon_number "11"; NDR "1"; maxTxScore "-1"; maxTxScore.noFit "-1"; novelGene "FALSE"; novelTranscript "TRUE"; txClassDescription "newWithin"; -9 Bambu exon 123386 123454 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000314367"; exon_number "13"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 123386 123454 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000356521"; exon_number "12"; NDR "0.790184378623962"; maxTxScore "0.209815621376038"; maxTxScore.noFit "0.209815621376038"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 123386 123454 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000377400"; exon_number "12"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 123386 123454 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000382447"; exon_number "11"; NDR "1"; maxTxScore "-1"; maxTxScore.noFit "-1"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 123386 123454 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000462513"; exon_number "3"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 123386 123747 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000464198"; exon_number "1"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 123386 123454 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000465014"; exon_number "12"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 123386 123454 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000475411"; exon_number "3"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 123386 123454 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000475990"; exon_number "3"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 123386 123454 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000487575"; exon_number "12"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 123386 123454 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000495302"; exon_number "10"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 123386 123454 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000611457"; exon_number "3"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 123386 123454 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000612045"; exon_number "13"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 123386 123454 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000613355"; exon_number "12"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 123386 123454 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000613508"; exon_number "10"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 123386 123454 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000616944"; exon_number "13"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 123386 123454 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000619157"; exon_number "9"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 123386 123454 . - . gene_id "ENSG00000172785"; transcript_id "BambuTx5"; exon_number "8"; NDR "1"; maxTxScore "-1"; maxTxScore.noFit "-1"; novelGene "FALSE"; novelTranscript "TRUE"; txClassDescription "compatible"; -9 Bambu exon 123386 123454 . - . gene_id "ENSG00000172785"; transcript_id "BambuTx6"; exon_number "5"; NDR "1"; maxTxScore "-1"; maxTxScore.noFit "-1"; novelGene "FALSE"; novelTranscript "TRUE"; txClassDescription "compatible"; -9 Bambu exon 123386 123454 . - . gene_id "ENSG00000172785"; transcript_id "BambuTx7"; exon_number "11"; NDR "1"; maxTxScore "-1"; maxTxScore.noFit "-1"; novelGene "FALSE"; novelTranscript "TRUE"; txClassDescription "newJunction"; -9 Bambu exon 123386 123454 . - . gene_id "ENSG00000172785"; transcript_id "BambuTx9"; exon_number "10"; NDR "1"; maxTxScore "-1"; maxTxScore.noFit "-1"; novelGene "FALSE"; novelTranscript "TRUE"; txClassDescription "newWithin"; -9 Bambu transcript 127744 128483 . . . gene_id "unstranded.Gene2"; transcript_id "BambuTx20"; NDR "1"; txScore ""; txScore.noFit ""; novelGene "TRUE"; novelTranscript "TRUE"; txClassDescription "newGene-unspliced"; -9 Bambu exon 127744 128483 . . . gene_id "unstranded.Gene2"; transcript_id "BambuTx20"; exon_number "1"; NDR "1"; maxTxScore "-1"; maxTxScore.noFit "-1"; novelGene "TRUE"; novelTranscript "TRUE"; txClassDescription "newGene-unspliced"; -9 Bambu exon 134979 135030 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000314367"; exon_number "12"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 134979 135030 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000356521"; exon_number "11"; NDR "0.790184378623962"; maxTxScore "0.209815621376038"; maxTxScore.noFit "0.209815621376038"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 134979 135030 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000377400"; exon_number "11"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 134979 135030 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000382447"; exon_number "10"; NDR "1"; maxTxScore "-1"; maxTxScore.noFit "-1"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 134979 135030 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000462513"; exon_number "2"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 134979 135030 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000465014"; exon_number "11"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 134979 135030 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000475411"; exon_number "2"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 134979 135030 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000475990"; exon_number "2"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 134979 135030 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000487575"; exon_number "11"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 134979 135030 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000495302"; exon_number "9"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 134979 135030 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000611457"; exon_number "2"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 134979 135030 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000612045"; exon_number "12"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 134979 135030 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000613355"; exon_number "11"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 134979 135030 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000613508"; exon_number "9"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 134979 135030 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000616944"; exon_number "12"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 134979 135030 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000619157"; exon_number "8"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 134979 135030 . - . gene_id "ENSG00000172785"; transcript_id "BambuTx5"; exon_number "7"; NDR "1"; maxTxScore "-1"; maxTxScore.noFit "-1"; novelGene "FALSE"; novelTranscript "TRUE"; txClassDescription "compatible"; -9 Bambu exon 134979 135030 . - . gene_id "ENSG00000172785"; transcript_id "BambuTx6"; exon_number "4"; NDR "1"; maxTxScore "-1"; maxTxScore.noFit "-1"; novelGene "FALSE"; novelTranscript "TRUE"; txClassDescription "compatible"; -9 Bambu exon 134979 135030 . - . gene_id "ENSG00000172785"; transcript_id "BambuTx7"; exon_number "10"; NDR "1"; maxTxScore "-1"; maxTxScore.noFit "-1"; novelGene "FALSE"; novelTranscript "TRUE"; txClassDescription "newJunction"; -9 Bambu exon 134979 135030 . - . gene_id "ENSG00000172785"; transcript_id "BambuTx9"; exon_number "9"; NDR "1"; maxTxScore "-1"; maxTxScore.noFit "-1"; novelGene "FALSE"; novelTranscript "TRUE"; txClassDescription "newWithin"; -9 Bambu exon 146102 146158 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000314367"; exon_number "11"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 146102 146158 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000356521"; exon_number "10"; NDR "0.790184378623962"; maxTxScore "0.209815621376038"; maxTxScore.noFit "0.209815621376038"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 146102 146158 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000377400"; exon_number "10"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 146102 146154 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000462513"; exon_number "1"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 146102 146158 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000465014"; exon_number "10"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 146102 149446 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000475411"; exon_number "1"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 146102 146140 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000475990"; exon_number "1"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 146102 146158 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000487575"; exon_number "10"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 146102 146158 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000495302"; exon_number "8"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 146102 148625 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000611457"; exon_number "1"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 146102 146158 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000612045"; exon_number "11"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 146102 146158 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000616944"; exon_number "11"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 146102 146158 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000619157"; exon_number "7"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 146102 146158 . - . gene_id "ENSG00000172785"; transcript_id "BambuTx6"; exon_number "3"; NDR "1"; maxTxScore "-1"; maxTxScore.noFit "-1"; novelGene "FALSE"; novelTranscript "TRUE"; txClassDescription "compatible"; -9 Bambu exon 146102 146158 . - . gene_id "ENSG00000172785"; transcript_id "BambuTx7"; exon_number "9"; NDR "1"; maxTxScore "-1"; maxTxScore.noFit "-1"; novelGene "FALSE"; novelTranscript "TRUE"; txClassDescription "newJunction"; -9 Bambu exon 146102 146158 . - . gene_id "ENSG00000172785"; transcript_id "BambuTx9"; exon_number "8"; NDR "1"; maxTxScore "-1"; maxTxScore.noFit "-1"; novelGene "FALSE"; novelTranscript "TRUE"; txClassDescription "newWithin"; -9 Bambu transcript 146114 172172 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000498044"; NDR "NA"; txScore ""; txScore.noFit ""; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 146114 146158 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000498044"; exon_number "9"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 147901 148040 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000465014"; exon_number "9"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu transcript 147950 164039 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000618361"; NDR "NA"; txScore ""; txScore.noFit ""; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 147950 148044 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000618361"; exon_number "8"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu transcript 150132 164039 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000618061"; NDR "NA"; txScore ""; txScore.noFit ""; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 150132 152078 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000618061"; exon_number "5"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 150509 150725 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000487575"; exon_number "9"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 150642 150725 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000498044"; exon_number "8"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 151305 151427 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000495302"; exon_number "7"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 151305 151427 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000612045"; exon_number "10"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 151305 151427 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000618361"; exon_number "7"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu transcript 151577 179088 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000613988"; NDR "NA"; txScore ""; txScore.noFit ""; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 151577 152078 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000613988"; exon_number "10"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu transcript 151745 161647 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000489272"; NDR "NA"; txScore ""; txScore.noFit ""; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 151745 152078 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000489272"; exon_number "4"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu transcript 152034 173325 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000616803"; NDR "NA"; txScore ""; txScore.noFit ""; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 152034 152078 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000314367"; exon_number "10"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 152034 152078 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000356521"; exon_number "9"; NDR "0.790184378623962"; maxTxScore "0.209815621376038"; maxTxScore.noFit "0.209815621376038"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 152034 152078 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000377400"; exon_number "9"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 152034 152078 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000382447"; exon_number "9"; NDR "1"; maxTxScore "-1"; maxTxScore.noFit "-1"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 152034 152078 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000465014"; exon_number "8"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 152034 152078 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000487575"; exon_number "8"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 152034 152078 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000495302"; exon_number "6"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 152034 152078 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000498044"; exon_number "7"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 152034 152078 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000612045"; exon_number "9"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 152034 152078 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000613355"; exon_number "10"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 152034 152078 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000613508"; exon_number "8"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 152034 152078 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000616803"; exon_number "8"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 152034 152078 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000616944"; exon_number "10"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 152034 152078 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000618361"; exon_number "6"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 152034 152078 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000619157"; exon_number "6"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 152034 152078 . - . gene_id "ENSG00000172785"; transcript_id "BambuTx5"; exon_number "6"; NDR "1"; maxTxScore "-1"; maxTxScore.noFit "-1"; novelGene "FALSE"; novelTranscript "TRUE"; txClassDescription "compatible"; -9 Bambu exon 152034 152078 . - . gene_id "ENSG00000172785"; transcript_id "BambuTx6"; exon_number "2"; NDR "1"; maxTxScore "-1"; maxTxScore.noFit "-1"; novelGene "FALSE"; novelTranscript "TRUE"; txClassDescription "compatible"; -9 Bambu exon 152034 152078 . - . gene_id "ENSG00000172785"; transcript_id "BambuTx9"; exon_number "7"; NDR "1"; maxTxScore "-1"; maxTxScore.noFit "-1"; novelGene "FALSE"; novelTranscript "TRUE"; txClassDescription "newWithin"; -9 Bambu transcript 152914 179025 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000377447"; NDR "0.653861284255981"; txScore ""; txScore.noFit ""; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 152914 154795 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000377447"; exon_number "8"; NDR "0.653861284255981"; maxTxScore "0.346138715744019"; maxTxScore.noFit "0.346138715744019"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 154709 154795 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000314367"; exon_number "9"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 154709 154795 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000356521"; exon_number "8"; NDR "0.790184378623962"; maxTxScore "0.209815621376038"; maxTxScore.noFit "0.209815621376038"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 154709 154795 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000377400"; exon_number "8"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 154709 154795 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000382447"; exon_number "8"; NDR "1"; maxTxScore "-1"; maxTxScore.noFit "-1"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 154709 154795 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000487575"; exon_number "7"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 154709 154795 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000489272"; exon_number "3"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 154709 154795 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000495302"; exon_number "5"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 154709 154795 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000498044"; exon_number "6"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 154709 154795 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000613355"; exon_number "9"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 154709 154795 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000613988"; exon_number "9"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 154709 154795 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000616803"; exon_number "7"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 154709 154795 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000616944"; exon_number "9"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 154709 154795 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000618361"; exon_number "5"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 154709 154795 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000619157"; exon_number "5"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 154709 154795 . - . gene_id "ENSG00000172785"; transcript_id "BambuTx5"; exon_number "5"; NDR "1"; maxTxScore "-1"; maxTxScore.noFit "-1"; novelGene "FALSE"; novelTranscript "TRUE"; txClassDescription "compatible"; -9 Bambu exon 154709 154798 . - . gene_id "ENSG00000172785"; transcript_id "BambuTx6"; exon_number "1"; NDR "1"; maxTxScore "-1"; maxTxScore.noFit "-1"; novelGene "FALSE"; novelTranscript "TRUE"; txClassDescription "compatible"; -9 Bambu exon 154709 154795 . - . gene_id "ENSG00000172785"; transcript_id "BambuTx7"; exon_number "8"; NDR "1"; maxTxScore "-1"; maxTxScore.noFit "-1"; novelGene "FALSE"; novelTranscript "TRUE"; txClassDescription "newJunction"; -9 Bambu transcript 154732 172179 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000620292"; NDR "NA"; txScore ""; txScore.noFit ""; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 154732 154795 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000620292"; exon_number "6"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu transcript 154770 179018 . - . gene_id "ENSG00000172785"; transcript_id "BambuTx10"; NDR "1"; txScore ""; txScore.noFit ""; novelGene "FALSE"; novelTranscript "TRUE"; txClassDescription "newJunction"; -9 Bambu exon 154770 154795 . - . gene_id "ENSG00000172785"; transcript_id "BambuTx10"; exon_number "9"; NDR "1"; maxTxScore "-1"; maxTxScore.noFit "-1"; novelGene "FALSE"; novelTranscript "TRUE"; txClassDescription "newJunction"; -9 Bambu exon 156481 156527 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000314367"; exon_number "8"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 156481 156527 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000356521"; exon_number "7"; NDR "0.790184378623962"; maxTxScore "0.209815621376038"; maxTxScore.noFit "0.209815621376038"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 156481 156527 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000377400"; exon_number "7"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 156481 156527 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000377447"; exon_number "7"; NDR "0.653861284255981"; maxTxScore "0.346138715744019"; maxTxScore.noFit "0.346138715744019"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 156481 156527 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000382447"; exon_number "7"; NDR "1"; maxTxScore "-1"; maxTxScore.noFit "-1"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 156481 156527 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000465014"; exon_number "7"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 156481 156527 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000487575"; exon_number "6"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 156481 156527 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000489272"; exon_number "2"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 156481 156527 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000495302"; exon_number "4"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 156481 156527 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000498044"; exon_number "5"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 156481 156527 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000612045"; exon_number "8"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 156481 156527 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000613355"; exon_number "8"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 156481 156527 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000613508"; exon_number "7"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 156481 156527 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000613988"; exon_number "8"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 156481 156527 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000616803"; exon_number "6"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 156481 156527 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000616944"; exon_number "8"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 156481 156527 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000618061"; exon_number "4"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 156481 156527 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000618361"; exon_number "4"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 156481 156527 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000619157"; exon_number "4"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 156481 156527 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000620292"; exon_number "5"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 156481 156527 . - . gene_id "ENSG00000172785"; transcript_id "BambuTx5"; exon_number "4"; NDR "1"; maxTxScore "-1"; maxTxScore.noFit "-1"; novelGene "FALSE"; novelTranscript "TRUE"; txClassDescription "compatible"; -9 Bambu exon 156481 156527 . - . gene_id "ENSG00000172785"; transcript_id "BambuTx7"; exon_number "7"; NDR "1"; maxTxScore "-1"; maxTxScore.noFit "-1"; novelGene "FALSE"; novelTranscript "TRUE"; txClassDescription "newJunction"; -9 Bambu exon 156481 156527 . - . gene_id "ENSG00000172785"; transcript_id "BambuTx9"; exon_number "6"; NDR "1"; maxTxScore "-1"; maxTxScore.noFit "-1"; novelGene "FALSE"; novelTranscript "TRUE"; txClassDescription "newWithin"; -9 Bambu exon 156481 156527 . - . gene_id "ENSG00000172785"; transcript_id "BambuTx10"; exon_number "8"; NDR "1"; maxTxScore "-1"; maxTxScore.noFit "-1"; novelGene "FALSE"; novelTranscript "TRUE"; txClassDescription "newJunction"; -9 Bambu exon 159996 160140 . - . gene_id "ENSG00000172785"; transcript_id "BambuTx10"; exon_number "7"; NDR "1"; maxTxScore "-1"; maxTxScore.noFit "-1"; novelGene "FALSE"; novelTranscript "TRUE"; txClassDescription "newJunction"; -9 Bambu exon 160001 160140 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000487575"; exon_number "5"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 160001 160140 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000498044"; exon_number "4"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 160001 160140 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000612045"; exon_number "7"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 160001 160140 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000620292"; exon_number "4"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu transcript 160088 179018 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000431099"; NDR "NA"; txScore ""; txScore.noFit ""; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 160088 160140 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000431099"; exon_number "8"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 161567 161654 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000465014"; exon_number "6"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 161567 161654 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000487575"; exon_number "4"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 161567 161647 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000489272"; exon_number "1"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 161567 161654 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000612045"; exon_number "6"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 161567 161654 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000616803"; exon_number "5"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 161567 161654 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000616944"; exon_number "7"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 161567 161654 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000618061"; exon_number "3"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 161567 161654 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000618361"; exon_number "3"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 161567 161654 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000619157"; exon_number "3"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 162432 162469 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000314367"; exon_number "7"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 162432 162469 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000356521"; exon_number "6"; NDR "0.790184378623962"; maxTxScore "0.209815621376038"; maxTxScore.noFit "0.209815621376038"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 162432 162469 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000377400"; exon_number "6"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 162432 162469 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000377447"; exon_number "6"; NDR "0.653861284255981"; maxTxScore "0.346138715744019"; maxTxScore.noFit "0.346138715744019"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 162432 162469 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000382447"; exon_number "6"; NDR "1"; maxTxScore "-1"; maxTxScore.noFit "-1"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 162432 162469 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000431099"; exon_number "7"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 162432 162469 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000465014"; exon_number "5"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 162432 162469 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000487575"; exon_number "3"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 162432 162469 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000495302"; exon_number "3"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 162432 162469 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000498044"; exon_number "3"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 162432 162469 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000612045"; exon_number "5"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 162432 162469 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000613355"; exon_number "7"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 162432 162469 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000613508"; exon_number "6"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 162432 162469 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000613988"; exon_number "7"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 162432 162469 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000616803"; exon_number "4"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 162432 162469 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000616944"; exon_number "6"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 162432 162469 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000618061"; exon_number "2"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 162432 162469 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000618361"; exon_number "2"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 162432 162469 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000619157"; exon_number "2"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 162432 162469 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000620292"; exon_number "3"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 162432 162469 . - . gene_id "ENSG00000172785"; transcript_id "BambuTx5"; exon_number "3"; NDR "1"; maxTxScore "-1"; maxTxScore.noFit "-1"; novelGene "FALSE"; novelTranscript "TRUE"; txClassDescription "compatible"; -9 Bambu exon 162432 162469 . - . gene_id "ENSG00000172785"; transcript_id "BambuTx7"; exon_number "6"; NDR "1"; maxTxScore "-1"; maxTxScore.noFit "-1"; novelGene "FALSE"; novelTranscript "TRUE"; txClassDescription "newJunction"; -9 Bambu exon 162432 162469 . - . gene_id "ENSG00000172785"; transcript_id "BambuTx9"; exon_number "5"; NDR "1"; maxTxScore "-1"; maxTxScore.noFit "-1"; novelGene "FALSE"; novelTranscript "TRUE"; txClassDescription "newWithin"; -9 Bambu exon 162432 162469 . - . gene_id "ENSG00000172785"; transcript_id "BambuTx10"; exon_number "6"; NDR "1"; maxTxScore "-1"; maxTxScore.noFit "-1"; novelGene "FALSE"; novelTranscript "TRUE"; txClassDescription "newJunction"; -9 Bambu transcript 163924 178999 . - . gene_id "ENSG00000172785"; transcript_id "BambuTx11"; NDR "1"; txScore ""; txScore.noFit ""; novelGene "FALSE"; novelTranscript "TRUE"; txClassDescription "newLastJunction:newLastExon"; -9 Bambu exon 163924 163998 . - . gene_id "ENSG00000172785"; transcript_id "BambuTx11"; exon_number "4"; NDR "1"; maxTxScore "-1"; maxTxScore.noFit "-1"; novelGene "FALSE"; novelTranscript "TRUE"; txClassDescription "newLastJunction:newLastExon"; -9 Bambu transcript 163926 179018 . - . gene_id "ENSG00000172785"; transcript_id "BambuTx12"; NDR "1"; txScore ""; txScore.noFit ""; novelGene "FALSE"; novelTranscript "TRUE"; txClassDescription "newLastJunction:newLastExon"; -9 Bambu exon 163926 163998 . - . gene_id "ENSG00000172785"; transcript_id "BambuTx12"; exon_number "5"; NDR "1"; maxTxScore "-1"; maxTxScore.noFit "-1"; novelGene "FALSE"; novelTranscript "TRUE"; txClassDescription "newLastJunction:newLastExon"; -9 Bambu exon 163978 164037 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000314367"; exon_number "6"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 163978 164037 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000356521"; exon_number "5"; NDR "0.790184378623962"; maxTxScore "0.209815621376038"; maxTxScore.noFit "0.209815621376038"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 163978 164037 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000377400"; exon_number "5"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 163978 164037 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000377447"; exon_number "5"; NDR "0.653861284255981"; maxTxScore "0.346138715744019"; maxTxScore.noFit "0.346138715744019"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 163978 164037 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000382447"; exon_number "5"; NDR "1"; maxTxScore "-1"; maxTxScore.noFit "-1"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 163978 164037 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000431099"; exon_number "6"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 163978 164037 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000487575"; exon_number "2"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 163978 164037 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000495302"; exon_number "2"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 163978 164037 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000498044"; exon_number "2"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 163978 164037 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000613355"; exon_number "6"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 163978 164037 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000613508"; exon_number "5"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 163978 164037 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000613988"; exon_number "6"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 163978 164037 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000616944"; exon_number "5"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 163978 164039 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000618061"; exon_number "1"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 163978 164039 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000618361"; exon_number "1"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 163978 164009 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000619157"; exon_number "1"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 163978 164037 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000620292"; exon_number "2"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 163978 164037 . - . gene_id "ENSG00000172785"; transcript_id "BambuTx5"; exon_number "2"; NDR "1"; maxTxScore "-1"; maxTxScore.noFit "-1"; novelGene "FALSE"; novelTranscript "TRUE"; txClassDescription "compatible"; -9 Bambu exon 163978 164037 . - . gene_id "ENSG00000172785"; transcript_id "BambuTx7"; exon_number "5"; NDR "1"; maxTxScore "-1"; maxTxScore.noFit "-1"; novelGene "FALSE"; novelTranscript "TRUE"; txClassDescription "newJunction"; -9 Bambu exon 163978 164037 . - . gene_id "ENSG00000172785"; transcript_id "BambuTx10"; exon_number "5"; NDR "1"; maxTxScore "-1"; maxTxScore.noFit "-1"; novelGene "FALSE"; novelTranscript "TRUE"; txClassDescription "newJunction"; -9 Bambu exon 164403 164448 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000616803"; exon_number "3"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 165983 166599 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000487575"; exon_number "1"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 165983 167605 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000495302"; exon_number "1"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu transcript 168248 169393 . . . gene_id "unstranded.Gene3"; transcript_id "BambuTx21"; NDR "1"; txScore ""; txScore.noFit ""; novelGene "TRUE"; novelTranscript "TRUE"; txClassDescription "newGene-unspliced"; -9 Bambu exon 168248 169393 . . . gene_id "unstranded.Gene3"; transcript_id "BambuTx21"; exon_number "1"; NDR "1"; maxTxScore "-1"; maxTxScore.noFit "-1"; novelGene "TRUE"; novelTranscript "TRUE"; txClassDescription "newGene-unspliced"; -9 Bambu transcript 171596 173371 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000483817"; NDR "NA"; txScore ""; txScore.noFit ""; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 171596 172172 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000483817"; exon_number "2"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu transcript 171953 179023 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000382389"; NDR "1"; txScore ""; txScore.noFit ""; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu transcript 171953 179045 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000382393"; NDR "0.281998038291931"; txScore ""; txScore.noFit ""; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 171953 173366 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000382389"; exon_number "4"; NDR "1"; maxTxScore "-1"; maxTxScore.noFit "-1"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 171953 173366 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000382393"; exon_number "3"; NDR "0.281998038291931"; maxTxScore "0.718001961708069"; maxTxScore.noFit "0.718001961708069"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 172081 172172 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000314367"; exon_number "5"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 172081 172172 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000356521"; exon_number "4"; NDR "0.790184378623962"; maxTxScore "0.209815621376038"; maxTxScore.noFit "0.209815621376038"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 172081 172172 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000377400"; exon_number "4"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 172081 172172 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000377447"; exon_number "4"; NDR "0.653861284255981"; maxTxScore "0.346138715744019"; maxTxScore.noFit "0.346138715744019"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 172081 172172 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000382447"; exon_number "4"; NDR "1"; maxTxScore "-1"; maxTxScore.noFit "-1"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 172081 172172 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000431099"; exon_number "5"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 172081 172172 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000465014"; exon_number "4"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 172081 172172 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000498044"; exon_number "1"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 172081 172172 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000612045"; exon_number "4"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 172081 172172 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000613355"; exon_number "5"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 172081 172172 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000613508"; exon_number "4"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 172081 172172 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000613988"; exon_number "5"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 172081 172172 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000616803"; exon_number "2"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 172081 172172 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000616944"; exon_number "4"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 172081 172179 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000620292"; exon_number "1"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 172081 172169 . - . gene_id "ENSG00000172785"; transcript_id "BambuTx5"; exon_number "1"; NDR "1"; maxTxScore "-1"; maxTxScore.noFit "-1"; novelGene "FALSE"; novelTranscript "TRUE"; txClassDescription "compatible"; -9 Bambu exon 172081 172172 . - . gene_id "ENSG00000172785"; transcript_id "BambuTx7"; exon_number "4"; NDR "1"; maxTxScore "-1"; maxTxScore.noFit "-1"; novelGene "FALSE"; novelTranscript "TRUE"; txClassDescription "newJunction"; -9 Bambu exon 172081 172172 . - . gene_id "ENSG00000172785"; transcript_id "BambuTx9"; exon_number "4"; NDR "1"; maxTxScore "-1"; maxTxScore.noFit "-1"; novelGene "FALSE"; novelTranscript "TRUE"; txClassDescription "newWithin"; -9 Bambu exon 172081 172172 . - . gene_id "ENSG00000172785"; transcript_id "BambuTx10"; exon_number "4"; NDR "1"; maxTxScore "-1"; maxTxScore.noFit "-1"; novelGene "FALSE"; novelTranscript "TRUE"; txClassDescription "newJunction"; -9 Bambu transcript 172130 179056 . - . gene_id "ENSG00000172785"; transcript_id "BambuTx13"; NDR "1"; txScore ""; txScore.noFit ""; novelGene "FALSE"; novelTranscript "TRUE"; txClassDescription "compatible"; -9 Bambu exon 172130 172172 . - . gene_id "ENSG00000172785"; transcript_id "BambuTx13"; exon_number "4"; NDR "1"; maxTxScore "-1"; maxTxScore.noFit "-1"; novelGene "FALSE"; novelTranscript "TRUE"; txClassDescription "compatible"; -9 Bambu transcript 172134 179026 . - . gene_id "ENSG00000172785"; transcript_id "BambuTx14"; NDR "1"; txScore ""; txScore.noFit ""; novelGene "FALSE"; novelTranscript "TRUE"; txClassDescription "compatible"; -9 Bambu exon 172134 172172 . - . gene_id "ENSG00000172785"; transcript_id "BambuTx14"; exon_number "5"; NDR "1"; maxTxScore "-1"; maxTxScore.noFit "-1"; novelGene "FALSE"; novelTranscript "TRUE"; txClassDescription "compatible"; -9 Bambu exon 173110 173366 . - . gene_id "ENSG00000172785"; transcript_id "BambuTx11"; exon_number "3"; NDR "1"; maxTxScore "-1"; maxTxScore.noFit "-1"; novelGene "FALSE"; novelTranscript "TRUE"; txClassDescription "newLastJunction:newLastExon"; -9 Bambu exon 173110 173366 . - . gene_id "ENSG00000172785"; transcript_id "BambuTx12"; exon_number "4"; NDR "1"; maxTxScore "-1"; maxTxScore.noFit "-1"; novelGene "FALSE"; novelTranscript "TRUE"; txClassDescription "newLastJunction:newLastExon"; -9 Bambu exon 173270 173366 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000314367"; exon_number "4"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 173270 173366 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000356521"; exon_number "3"; NDR "0.790184378623962"; maxTxScore "0.209815621376038"; maxTxScore.noFit "0.209815621376038"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 173270 173366 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000377400"; exon_number "3"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 173270 173366 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000377447"; exon_number "3"; NDR "0.653861284255981"; maxTxScore "0.346138715744019"; maxTxScore.noFit "0.346138715744019"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 173270 173366 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000382447"; exon_number "3"; NDR "1"; maxTxScore "-1"; maxTxScore.noFit "-1"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 173270 173366 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000431099"; exon_number "4"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 173270 173366 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000465014"; exon_number "3"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 173270 173371 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000483817"; exon_number "1"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 173270 173366 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000612045"; exon_number "3"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 173270 173366 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000613355"; exon_number "4"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 173270 173366 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000613508"; exon_number "3"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 173270 173366 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000613988"; exon_number "4"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 173270 173325 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000616803"; exon_number "1"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 173270 173366 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000616944"; exon_number "3"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 173270 173366 . - . gene_id "ENSG00000172785"; transcript_id "BambuTx7"; exon_number "3"; NDR "1"; maxTxScore "-1"; maxTxScore.noFit "-1"; novelGene "FALSE"; novelTranscript "TRUE"; txClassDescription "newJunction"; -9 Bambu exon 173270 173366 . - . gene_id "ENSG00000172785"; transcript_id "BambuTx9"; exon_number "3"; NDR "1"; maxTxScore "-1"; maxTxScore.noFit "-1"; novelGene "FALSE"; novelTranscript "TRUE"; txClassDescription "newWithin"; -9 Bambu exon 173270 173366 . - . gene_id "ENSG00000172785"; transcript_id "BambuTx10"; exon_number "3"; NDR "1"; maxTxScore "-1"; maxTxScore.noFit "-1"; novelGene "FALSE"; novelTranscript "TRUE"; txClassDescription "newJunction"; -9 Bambu exon 173270 173366 . - . gene_id "ENSG00000172785"; transcript_id "BambuTx13"; exon_number "3"; NDR "1"; maxTxScore "-1"; maxTxScore.noFit "-1"; novelGene "FALSE"; novelTranscript "TRUE"; txClassDescription "compatible"; -9 Bambu exon 173270 173366 . - . gene_id "ENSG00000172785"; transcript_id "BambuTx14"; exon_number "4"; NDR "1"; maxTxScore "-1"; maxTxScore.noFit "-1"; novelGene "FALSE"; novelTranscript "TRUE"; txClassDescription "compatible"; -9 Bambu exon 175698 175784 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000314367"; exon_number "3"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 175698 175784 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000356521"; exon_number "2"; NDR "0.790184378623962"; maxTxScore "0.209815621376038"; maxTxScore.noFit "0.209815621376038"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 175698 175784 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000377400"; exon_number "2"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 175698 175784 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000377447"; exon_number "2"; NDR "0.653861284255981"; maxTxScore "0.346138715744019"; maxTxScore.noFit "0.346138715744019"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 175698 175784 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000382389"; exon_number "3"; NDR "1"; maxTxScore "-1"; maxTxScore.noFit "-1"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 175698 175784 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000382393"; exon_number "2"; NDR "0.281998038291931"; maxTxScore "0.718001961708069"; maxTxScore.noFit "0.718001961708069"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 175698 175784 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000382447"; exon_number "2"; NDR "1"; maxTxScore "-1"; maxTxScore.noFit "-1"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 175698 175784 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000431099"; exon_number "3"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 175698 175784 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000465014"; exon_number "2"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 175698 175784 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000612045"; exon_number "2"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 175698 175784 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000613355"; exon_number "3"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 175698 175784 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000613508"; exon_number "2"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 175698 175784 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000613988"; exon_number "3"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 175698 175784 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000616944"; exon_number "2"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 175698 175784 . - . gene_id "ENSG00000172785"; transcript_id "BambuTx7"; exon_number "2"; NDR "1"; maxTxScore "-1"; maxTxScore.noFit "-1"; novelGene "FALSE"; novelTranscript "TRUE"; txClassDescription "newJunction"; -9 Bambu exon 175698 175784 . - . gene_id "ENSG00000172785"; transcript_id "BambuTx9"; exon_number "2"; NDR "1"; maxTxScore "-1"; maxTxScore.noFit "-1"; novelGene "FALSE"; novelTranscript "TRUE"; txClassDescription "newWithin"; -9 Bambu exon 175698 175784 . - . gene_id "ENSG00000172785"; transcript_id "BambuTx10"; exon_number "2"; NDR "1"; maxTxScore "-1"; maxTxScore.noFit "-1"; novelGene "FALSE"; novelTranscript "TRUE"; txClassDescription "newJunction"; -9 Bambu exon 175698 175784 . - . gene_id "ENSG00000172785"; transcript_id "BambuTx11"; exon_number "2"; NDR "1"; maxTxScore "-1"; maxTxScore.noFit "-1"; novelGene "FALSE"; novelTranscript "TRUE"; txClassDescription "newLastJunction:newLastExon"; -9 Bambu exon 175698 175784 . - . gene_id "ENSG00000172785"; transcript_id "BambuTx12"; exon_number "3"; NDR "1"; maxTxScore "-1"; maxTxScore.noFit "-1"; novelGene "FALSE"; novelTranscript "TRUE"; txClassDescription "newLastJunction:newLastExon"; -9 Bambu exon 175698 175784 . - . gene_id "ENSG00000172785"; transcript_id "BambuTx13"; exon_number "2"; NDR "1"; maxTxScore "-1"; maxTxScore.noFit "-1"; novelGene "FALSE"; novelTranscript "TRUE"; txClassDescription "compatible"; -9 Bambu exon 175698 175784 . - . gene_id "ENSG00000172785"; transcript_id "BambuTx14"; exon_number "3"; NDR "1"; maxTxScore "-1"; maxTxScore.noFit "-1"; novelGene "FALSE"; novelTranscript "TRUE"; txClassDescription "compatible"; -9 Bambu transcript 175718 179054 . - . gene_id "ENSG00000172785"; transcript_id "BambuTx15"; NDR "1"; txScore ""; txScore.noFit ""; novelGene "FALSE"; novelTranscript "TRUE"; txClassDescription "compatible"; -9 Bambu exon 175718 175784 . - . gene_id "ENSG00000172785"; transcript_id "BambuTx15"; exon_number "2"; NDR "1"; maxTxScore "-1"; maxTxScore.noFit "-1"; novelGene "FALSE"; novelTranscript "TRUE"; txClassDescription "compatible"; -9 Bambu exon 177723 177820 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000314367"; exon_number "2"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 177723 177820 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000382389"; exon_number "2"; NDR "1"; maxTxScore "-1"; maxTxScore.noFit "-1"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 177723 177820 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000431099"; exon_number "2"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 177723 177820 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000613355"; exon_number "2"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 177723 177820 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000613988"; exon_number "2"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 177723 177820 . - . gene_id "ENSG00000172785"; transcript_id "BambuTx12"; exon_number "2"; NDR "1"; maxTxScore "-1"; maxTxScore.noFit "-1"; novelGene "FALSE"; novelTranscript "TRUE"; txClassDescription "newLastJunction:newLastExon"; -9 Bambu exon 177723 177820 . - . gene_id "ENSG00000172785"; transcript_id "BambuTx14"; exon_number "2"; NDR "1"; maxTxScore "-1"; maxTxScore.noFit "-1"; novelGene "FALSE"; novelTranscript "TRUE"; txClassDescription "compatible"; -9 Bambu exon 178816 179047 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000314367"; exon_number "1"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 178816 179058 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000356521"; exon_number "1"; NDR "0.790184378623962"; maxTxScore "0.209815621376038"; maxTxScore.noFit "0.209815621376038"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 178816 179147 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000377400"; exon_number "1"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 178816 179025 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000377447"; exon_number "1"; NDR "0.653861284255981"; maxTxScore "0.346138715744019"; maxTxScore.noFit "0.346138715744019"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 178816 179023 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000382389"; exon_number "1"; NDR "1"; maxTxScore "-1"; maxTxScore.noFit "-1"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 178816 179045 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000382393"; exon_number "1"; NDR "0.281998038291931"; maxTxScore "0.718001961708069"; maxTxScore.noFit "0.718001961708069"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 178816 179021 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000382447"; exon_number "1"; NDR "1"; maxTxScore "-1"; maxTxScore.noFit "-1"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 178816 179018 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000431099"; exon_number "1"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 178816 179042 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000465014"; exon_number "1"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 178816 179012 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000612045"; exon_number "1"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 178816 179016 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000613355"; exon_number "1"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 178816 179008 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000613508"; exon_number "1"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 178816 179088 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000613988"; exon_number "1"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 178816 179052 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000616944"; exon_number "1"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 178816 179056 . - . gene_id "ENSG00000172785"; transcript_id "BambuTx7"; exon_number "1"; NDR "1"; maxTxScore "-1"; maxTxScore.noFit "-1"; novelGene "FALSE"; novelTranscript "TRUE"; txClassDescription "newJunction"; -9 Bambu exon 178816 179016 . - . gene_id "ENSG00000172785"; transcript_id "BambuTx9"; exon_number "1"; NDR "1"; maxTxScore "-1"; maxTxScore.noFit "-1"; novelGene "FALSE"; novelTranscript "TRUE"; txClassDescription "newWithin"; -9 Bambu exon 178816 179018 . - . gene_id "ENSG00000172785"; transcript_id "BambuTx10"; exon_number "1"; NDR "1"; maxTxScore "-1"; maxTxScore.noFit "-1"; novelGene "FALSE"; novelTranscript "TRUE"; txClassDescription "newJunction"; -9 Bambu exon 178816 178999 . - . gene_id "ENSG00000172785"; transcript_id "BambuTx11"; exon_number "1"; NDR "1"; maxTxScore "-1"; maxTxScore.noFit "-1"; novelGene "FALSE"; novelTranscript "TRUE"; txClassDescription "newLastJunction:newLastExon"; -9 Bambu exon 178816 179018 . - . gene_id "ENSG00000172785"; transcript_id "BambuTx12"; exon_number "1"; NDR "1"; maxTxScore "-1"; maxTxScore.noFit "-1"; novelGene "FALSE"; novelTranscript "TRUE"; txClassDescription "newLastJunction:newLastExon"; -9 Bambu exon 178816 179056 . - . gene_id "ENSG00000172785"; transcript_id "BambuTx13"; exon_number "1"; NDR "1"; maxTxScore "-1"; maxTxScore.noFit "-1"; novelGene "FALSE"; novelTranscript "TRUE"; txClassDescription "compatible"; -9 Bambu exon 178816 179026 . - . gene_id "ENSG00000172785"; transcript_id "BambuTx14"; exon_number "1"; NDR "1"; maxTxScore "-1"; maxTxScore.noFit "-1"; novelGene "FALSE"; novelTranscript "TRUE"; txClassDescription "compatible"; -9 Bambu exon 178816 179054 . - . gene_id "ENSG00000172785"; transcript_id "BambuTx15"; exon_number "1"; NDR "1"; maxTxScore "-1"; maxTxScore.noFit "-1"; novelGene "FALSE"; novelTranscript "TRUE"; txClassDescription "compatible"; -9 Bambu transcript 212824 215741 . - . gene_id "ENSG00000183784"; transcript_id "ENST00000382387"; NDR "NA"; txScore ""; txScore.noFit ""; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 212824 215741 . - . gene_id "ENSG00000183784"; transcript_id "ENST00000382387"; exon_number "1"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu transcript 214854 286636 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000469197"; NDR "NA"; txScore ""; txScore.noFit ""; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 214854 215029 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000469197"; exon_number "1"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu transcript 214865 465259 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000432829"; NDR "NA"; txScore ""; txScore.noFit ""; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu transcript 214865 340620 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000524396"; NDR "NA"; txScore ""; txScore.noFit ""; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 214865 215029 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000432829"; exon_number "1"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 214865 215029 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000524396"; exon_number "1"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu transcript 214868 340620 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000454469"; NDR "NA"; txScore ""; txScore.noFit ""; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 214868 215029 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000454469"; exon_number "1"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu transcript 215171 289579 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000479404"; NDR "NA"; txScore ""; txScore.noFit ""; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 215171 215416 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000479404"; exon_number "1"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 220748 220863 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000524396"; exon_number "2"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu transcript 267966 273002 . - . gene_id "ENSG00000235880"; transcript_id "ENST00000429661"; NDR "NA"; txScore ""; txScore.noFit ""; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 267966 268273 . - . gene_id "ENSG00000235880"; transcript_id "ENST00000429661"; exon_number "2"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 271627 271729 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000432829"; exon_number "2"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 271627 271729 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000454469"; exon_number "2"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 271627 271729 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000469197"; exon_number "2"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 271627 271729 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000479404"; exon_number "2"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 271627 271729 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000524396"; exon_number "3"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 272905 273002 . - . gene_id "ENSG00000235880"; transcript_id "ENST00000429661"; exon_number "1"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu transcript 273048 465259 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000453981"; NDR "NA"; txScore ""; txScore.noFit ""; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 273048 273100 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000453981"; exon_number "1"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu transcript 273050 340620 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000382341"; NDR "NA"; txScore ""; txScore.noFit ""; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu transcript 273050 304703 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000487230"; NDR "NA"; txScore ""; txScore.noFit ""; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 273050 273100 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000382341"; exon_number "1"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 273050 273100 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000487230"; exon_number "1"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu transcript 273059 381387 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000483757"; NDR "NA"; txScore ""; txScore.noFit ""; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 273059 273100 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000483757"; exon_number "1"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu transcript 273066 312941 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000478380"; NDR "NA"; txScore ""; txScore.noFit ""; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 273066 273100 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000478380"; exon_number "1"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu transcript 273070 464526 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000469391"; NDR "NA"; txScore ""; txScore.noFit ""; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 273070 273100 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000469391"; exon_number "1"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu transcript 273084 465241 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000495184"; NDR "NA"; txScore ""; txScore.noFit ""; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 273084 273100 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000495184"; exon_number "1"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 276994 277086 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000469197"; exon_number "3"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 280791 280905 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000487230"; exon_number "2"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 284375 284567 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000469197"; exon_number "4"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 286461 286636 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000382341"; exon_number "2"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 286461 286636 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000432829"; exon_number "3"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 286461 286636 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000453981"; exon_number "2"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 286461 286636 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000454469"; exon_number "3"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 286461 286636 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000469197"; exon_number "5"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 286461 286636 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000469391"; exon_number "2"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 286461 286636 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000478380"; exon_number "2"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 286461 286636 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000479404"; exon_number "3"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 286461 286636 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000483757"; exon_number "2"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 286461 286636 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000487230"; exon_number "3"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 286461 286636 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000495184"; exon_number "2"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 286461 286636 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000524396"; exon_number "4"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 289510 289581 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000382341"; exon_number "3"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 289510 289581 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000432829"; exon_number "4"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 289510 289581 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000453981"; exon_number "3"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 289510 289581 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000454469"; exon_number "4"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 289510 289581 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000469391"; exon_number "3"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 289510 289581 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000478380"; exon_number "3"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 289510 289579 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000479404"; exon_number "4"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 289510 289581 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000483757"; exon_number "3"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 289510 289581 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000487230"; exon_number "4"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 289510 289581 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000495184"; exon_number "3"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 289510 289581 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000524396"; exon_number "5"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 304581 304704 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000382341"; exon_number "4"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 304581 304704 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000432829"; exon_number "5"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 304581 304704 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000453981"; exon_number "4"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 304581 304704 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000454469"; exon_number "5"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 304581 304704 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000469391"; exon_number "4"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 304581 304704 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000478380"; exon_number "4"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 304581 304704 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000483757"; exon_number "4"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 304581 304703 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000487230"; exon_number "5"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 304581 304704 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000495184"; exon_number "4"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 304581 304704 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000524396"; exon_number "6"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 311954 312166 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000382341"; exon_number "5"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 311954 312166 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000432829"; exon_number "6"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 311954 312166 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000453981"; exon_number "5"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 311954 312166 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000454469"; exon_number "6"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 311954 312166 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000469391"; exon_number "5"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 311954 312941 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000478380"; exon_number "5"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 311954 312166 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000483757"; exon_number "5"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 311954 312166 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000495184"; exon_number "5"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 311954 312166 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000524396"; exon_number "7"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu transcript 311958 314466 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000474772"; NDR "NA"; txScore ""; txScore.noFit ""; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 311958 312166 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000474772"; exon_number "1"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 314292 314466 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000474772"; exon_number "2"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 317043 317128 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000382341"; exon_number "6"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 317043 317128 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000432829"; exon_number "7"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 317043 317128 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000453981"; exon_number "6"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 317043 317128 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000454469"; exon_number "7"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 317043 317128 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000469391"; exon_number "6"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 317043 317128 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000483757"; exon_number "6"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 317043 317128 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000495184"; exon_number "6"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 317043 317128 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000524396"; exon_number "8"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 325671 325737 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000382341"; exon_number "7"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 325671 325737 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000432829"; exon_number "8"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 325671 325737 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000453981"; exon_number "7"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 325671 325737 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000454469"; exon_number "8"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 325671 325737 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000469391"; exon_number "7"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 325671 325737 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000483757"; exon_number "7"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 325671 325737 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000495184"; exon_number "7"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 325671 325737 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000524396"; exon_number "9"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 328022 328171 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000382341"; exon_number "8"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 328022 328171 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000432829"; exon_number "9"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 328022 328171 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000453981"; exon_number "8"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 328022 328171 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000454469"; exon_number "9"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 328022 328171 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000469391"; exon_number "8"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 328022 328171 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000483757"; exon_number "8"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 328022 328171 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000495184"; exon_number "8"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 328022 328171 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000524396"; exon_number "10"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 332398 332478 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000382341"; exon_number "9"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 332398 332478 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000432829"; exon_number "10"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 332398 332478 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000453981"; exon_number "9"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 332398 332478 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000454469"; exon_number "10"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 332398 332478 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000469391"; exon_number "9"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 332398 332478 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000483757"; exon_number "9"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 332398 332478 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000495184"; exon_number "9"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 332398 332478 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000524396"; exon_number "11"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 334225 334384 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000382341"; exon_number "10"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 334225 334384 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000432829"; exon_number "11"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 334225 334384 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000453981"; exon_number "10"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 334225 334384 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000454469"; exon_number "11"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 334225 334384 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000469391"; exon_number "10"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 334225 334384 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000483757"; exon_number "10"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 334225 334384 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000495184"; exon_number "10"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 334225 334384 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000524396"; exon_number "12"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 336582 336718 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000382341"; exon_number "11"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 336582 336718 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000432829"; exon_number "12"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 336582 336718 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000453981"; exon_number "11"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 336582 336718 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000454469"; exon_number "12"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 336582 336718 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000469391"; exon_number "11"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 336582 336718 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000483757"; exon_number "11"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 336582 336718 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000495184"; exon_number "11"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 336582 336718 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000524396"; exon_number "13"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 339006 339099 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000382341"; exon_number "12"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 339006 339099 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000432829"; exon_number "13"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 339006 339099 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000453981"; exon_number "12"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 339006 339099 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000454469"; exon_number "13"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 339006 339099 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000469391"; exon_number "12"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 339006 339099 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000483757"; exon_number "12"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 339006 339099 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000495184"; exon_number "12"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 339006 339099 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000524396"; exon_number "14"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 340159 340620 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000382341"; exon_number "13"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 340159 340321 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000432829"; exon_number "14"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 340159 340321 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000453981"; exon_number "13"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 340159 340620 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000454469"; exon_number "14"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 340159 340321 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000469391"; exon_number "13"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 340159 340321 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000483757"; exon_number "13"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 340159 340321 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000495184"; exon_number "13"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 340159 340620 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000524396"; exon_number "15"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 365591 366552 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000483757"; exon_number "14"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu transcript 366229 405099 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000382331"; NDR "NA"; txScore ""; txScore.noFit ""; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 366229 366552 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000382331"; exon_number "1"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu transcript 366251 465255 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000382329"; NDR "NA"; txScore ""; txScore.noFit ""; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 366251 366552 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000382329"; exon_number "1"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 368018 368300 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000382329"; exon_number "2"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 368018 368135 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000382331"; exon_number "2"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 368018 368135 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000432829"; exon_number "15"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 368018 368135 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000453981"; exon_number "14"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 368018 368135 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000469391"; exon_number "14"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 368018 368135 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000483757"; exon_number "15"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 368018 370300 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000495184"; exon_number "14"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 369222 369447 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000483757"; exon_number "16"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 370230 370300 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000382329"; exon_number "3"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 370230 370300 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000382331"; exon_number "3"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 370230 370300 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000432829"; exon_number "16"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 370230 370300 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000453981"; exon_number "15"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 370230 370300 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000469391"; exon_number "15"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 370230 370300 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000483757"; exon_number "17"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 371428 371566 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000382329"; exon_number "4"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 371428 371566 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000432829"; exon_number "17"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 371428 371566 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000453981"; exon_number "16"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 371428 371566 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000469391"; exon_number "16"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 371428 371566 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000483757"; exon_number "18"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 371428 371566 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000495184"; exon_number "15"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 372185 372286 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000382329"; exon_number "5"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 372185 372286 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000382331"; exon_number "4"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 372185 372286 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000432829"; exon_number "18"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 372185 372286 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000453981"; exon_number "17"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 372185 372286 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000469391"; exon_number "17"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 372185 372286 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000483757"; exon_number "19"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 372185 372286 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000495184"; exon_number "16"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 376210 376305 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000382329"; exon_number "6"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 376210 376305 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000382331"; exon_number "5"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 376210 376305 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000432829"; exon_number "19"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 376210 376305 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000453981"; exon_number "18"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 376210 376305 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000469391"; exon_number "18"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 376210 376305 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000483757"; exon_number "20"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 376210 376305 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000495184"; exon_number "17"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 376977 377211 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000382329"; exon_number "7"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 376977 377211 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000382331"; exon_number "6"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 376977 377211 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000432829"; exon_number "20"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 376977 377211 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000453981"; exon_number "19"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 376977 377211 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000469391"; exon_number "19"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 376977 377211 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000483757"; exon_number "21"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 376977 377211 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000495184"; exon_number "18"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 379771 379935 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000382329"; exon_number "8"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 379771 379935 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000382331"; exon_number "7"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 379771 379935 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000432829"; exon_number "21"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 379771 379935 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000453981"; exon_number "20"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 379771 379935 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000469391"; exon_number "20"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 379771 379935 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000483757"; exon_number "22"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 379771 379935 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000495184"; exon_number "19"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 380279 381387 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000483757"; exon_number "23"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 382513 382685 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000382329"; exon_number "9"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 382513 382685 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000382331"; exon_number "8"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 382513 382685 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000432829"; exon_number "22"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 382513 382685 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000453981"; exon_number "21"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 382513 382685 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000469391"; exon_number "21"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 382513 382685 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000495184"; exon_number "20"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 386331 386426 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000382329"; exon_number "10"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 386331 386426 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000382331"; exon_number "9"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 386331 386426 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000432829"; exon_number "23"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 386331 386426 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000453981"; exon_number "22"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 386331 386426 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000495184"; exon_number "21"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 390471 390566 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000382329"; exon_number "11"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 390471 390566 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000382331"; exon_number "10"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 390471 390566 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000432829"; exon_number "24"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 390471 390566 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000453981"; exon_number "23"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 390471 390566 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000469391"; exon_number "22"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 390471 390566 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000495184"; exon_number "22"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 396785 396934 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000382329"; exon_number "12"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 396785 396934 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000382331"; exon_number "11"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 396785 396934 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000432829"; exon_number "25"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 396785 396934 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000453981"; exon_number "24"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 396785 396934 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000469391"; exon_number "23"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 396785 396934 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000495184"; exon_number "23"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 399146 399259 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000382329"; exon_number "13"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 399146 399259 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000382331"; exon_number "12"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 399146 399259 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000432829"; exon_number "26"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 399146 399259 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000453981"; exon_number "25"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 399146 399259 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000469391"; exon_number "24"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 399146 399259 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000495184"; exon_number "24"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 404918 405073 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000382329"; exon_number "14"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 404918 405099 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000382331"; exon_number "13"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 404918 405073 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000432829"; exon_number "27"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 404918 405073 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000453981"; exon_number "26"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 404918 405073 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000469391"; exon_number "25"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 404918 405073 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000495184"; exon_number "25"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 406930 407069 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000382329"; exon_number "15"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 406930 407069 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000432829"; exon_number "28"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 406930 407069 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000453981"; exon_number "27"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 406930 407069 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000469391"; exon_number "26"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 406930 407069 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000495184"; exon_number "26"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 414782 414951 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000382329"; exon_number "16"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 414782 414951 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000432829"; exon_number "29"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 414782 414951 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000453981"; exon_number "28"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 414782 414951 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000469391"; exon_number "27"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 414782 414951 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000495184"; exon_number "27"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 418068 418207 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000382329"; exon_number "17"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 418068 418207 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000432829"; exon_number "30"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 418068 418207 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000453981"; exon_number "29"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 418068 418207 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000469391"; exon_number "28"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 418068 418207 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000495184"; exon_number "28"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu transcript 420116 426953 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000493666"; NDR "NA"; txScore ""; txScore.noFit ""; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 420116 420180 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000493666"; exon_number "1"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 420401 420583 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000382329"; exon_number "18"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 420401 420583 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000432829"; exon_number "31"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 420401 420583 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000453981"; exon_number "30"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 420401 420583 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000469391"; exon_number "29"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 420401 420583 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000493666"; exon_number "2"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 420401 420583 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000495184"; exon_number "29"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 420949 421078 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000382329"; exon_number "19"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 420949 421078 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000432829"; exon_number "32"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 420949 421078 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000453981"; exon_number "31"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 420949 421078 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000469391"; exon_number "30"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 420949 421078 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000493666"; exon_number "3"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 420949 421078 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000495184"; exon_number "30"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 422048 422135 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000382329"; exon_number "20"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 422048 422135 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000432829"; exon_number "33"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 422048 422135 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000453981"; exon_number "32"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 422048 422135 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000469391"; exon_number "31"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 422048 422135 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000493666"; exon_number "4"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 422048 422135 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000495184"; exon_number "31"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 426885 426981 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000382329"; exon_number "21"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 426885 426981 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000432829"; exon_number "34"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 426885 426981 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000453981"; exon_number "33"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 426885 426981 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000469391"; exon_number "32"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 426885 426953 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000493666"; exon_number "5"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 426885 426981 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000495184"; exon_number "32"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 428362 428496 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000382329"; exon_number "22"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 428362 428496 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000432829"; exon_number "35"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 428362 428496 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000453981"; exon_number "34"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 428362 428496 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000469391"; exon_number "33"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 428362 428496 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000495184"; exon_number "33"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 429702 429854 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000382329"; exon_number "23"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 429702 429854 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000432829"; exon_number "36"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 429702 429854 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000453981"; exon_number "35"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 429702 429854 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000469391"; exon_number "34"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 429702 429854 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000495184"; exon_number "34"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 432166 432324 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000382329"; exon_number "24"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 432166 432324 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000432829"; exon_number "37"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 432166 432324 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000453981"; exon_number "36"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 432166 432324 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000469391"; exon_number "35"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 432166 432324 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000495184"; exon_number "35"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 433875 433975 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000382329"; exon_number "25"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 433875 433975 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000432829"; exon_number "38"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 433875 433975 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000453981"; exon_number "37"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 433875 433975 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000469391"; exon_number "36"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 433875 433975 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000495184"; exon_number "36"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 434783 434975 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000382329"; exon_number "26"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 434783 434975 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000432829"; exon_number "39"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 434783 434975 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000453981"; exon_number "38"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 434783 434975 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000469391"; exon_number "37"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 434783 434975 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000495184"; exon_number "37"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 439245 439388 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000382329"; exon_number "27"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 439245 439388 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000432829"; exon_number "40"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 439245 439388 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000453981"; exon_number "39"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 439245 439388 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000469391"; exon_number "38"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 439245 439388 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000495184"; exon_number "38"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 441286 441417 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000382329"; exon_number "28"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 441286 441417 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000432829"; exon_number "41"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 441286 441417 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000453981"; exon_number "40"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 441286 441417 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000469391"; exon_number "39"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 441286 441417 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000495184"; exon_number "39"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 441875 442009 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000382329"; exon_number "29"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 441875 442009 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000432829"; exon_number "42"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 441875 442009 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000453981"; exon_number "41"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 441875 442009 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000469391"; exon_number "40"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 441875 442009 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000495184"; exon_number "40"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 443427 443516 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000382329"; exon_number "30"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 443427 443516 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000432829"; exon_number "43"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 443427 443516 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000453981"; exon_number "42"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 443427 443516 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000469391"; exon_number "41"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 443427 443516 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000495184"; exon_number "41"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 446370 446606 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000382329"; exon_number "31"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 446370 446606 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000432829"; exon_number "44"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 446370 446606 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000453981"; exon_number "43"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 446370 446606 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000469391"; exon_number "42"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 446370 446606 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000495184"; exon_number "42"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 449784 449927 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000382329"; exon_number "32"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 449784 449927 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000432829"; exon_number "45"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 449784 449927 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000453981"; exon_number "44"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 449784 449927 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000469391"; exon_number "43"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 449784 449927 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000495184"; exon_number "43"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 452011 452117 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000382329"; exon_number "33"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 452011 452117 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000432829"; exon_number "46"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 452011 452117 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000453981"; exon_number "45"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 452011 452117 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000469391"; exon_number "44"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 452011 452117 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000495184"; exon_number "44"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu transcript 452492 469836 . - . gene_id "ENSG00000227155"; transcript_id "ENST00000591577"; NDR "NA"; txScore ""; txScore.noFit ""; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 452492 452948 . - . gene_id "ENSG00000227155"; transcript_id "ENST00000591577"; exon_number "5"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu transcript 452493 456207 . - . gene_id "ENSG00000227155"; transcript_id "ENST00000628764"; NDR "NA"; txScore ""; txScore.noFit ""; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 452493 452948 . - . gene_id "ENSG00000227155"; transcript_id "ENST00000628764"; exon_number "3"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu transcript 454304 492248 . - . gene_id "ENSG00000227155"; transcript_id "ENST00000415004"; NDR "NA"; txScore ""; txScore.noFit ""; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 454304 454606 . - . gene_id "ENSG00000227155"; transcript_id "ENST00000415004"; exon_number "4"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu transcript 454432 456988 . - . gene_id "ENSG00000227155"; transcript_id "ENST00000585944"; NDR "NA"; txScore ""; txScore.noFit ""; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 454432 454606 . - . gene_id "ENSG00000227155"; transcript_id "ENST00000585944"; exon_number "2"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 454439 454606 . - . gene_id "ENSG00000227155"; transcript_id "ENST00000591577"; exon_number "4"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu transcript 454447 469802 . - . gene_id "ENSG00000227155"; transcript_id "ENST00000589287"; NDR "NA"; txScore ""; txScore.noFit ""; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 454447 454606 . - . gene_id "ENSG00000227155"; transcript_id "ENST00000589287"; exon_number "4"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 454507 454606 . - . gene_id "ENSG00000227155"; transcript_id "ENST00000628764"; exon_number "2"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu transcript 454576 469802 . - . gene_id "ENSG00000227155"; transcript_id "ENST00000589387"; NDR "NA"; txScore ""; txScore.noFit ""; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 454576 454606 . - . gene_id "ENSG00000227155"; transcript_id "ENST00000589387"; exon_number "4"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu transcript 454585 470961 . - . gene_id "ENSG00000227155"; transcript_id "ENST00000586805"; NDR "NA"; txScore ""; txScore.noFit ""; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 454585 454606 . - . gene_id "ENSG00000227155"; transcript_id "ENST00000586805"; exon_number "3"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu transcript 456201 460507 . - . gene_id "ENSG00000227155"; transcript_id "ENST00000585631"; NDR "NA"; txScore ""; txScore.noFit ""; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 456201 456703 . - . gene_id "ENSG00000227155"; transcript_id "ENST00000415004"; exon_number "3"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 456201 456703 . - . gene_id "ENSG00000227155"; transcript_id "ENST00000585631"; exon_number "2"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 456201 456988 . - . gene_id "ENSG00000227155"; transcript_id "ENST00000585944"; exon_number "1"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 456201 456703 . - . gene_id "ENSG00000227155"; transcript_id "ENST00000586805"; exon_number "2"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 456201 456703 . - . gene_id "ENSG00000227155"; transcript_id "ENST00000589287"; exon_number "3"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 456201 456703 . - . gene_id "ENSG00000227155"; transcript_id "ENST00000589387"; exon_number "3"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 456201 456703 . - . gene_id "ENSG00000227155"; transcript_id "ENST00000591577"; exon_number "3"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 456201 456207 . - . gene_id "ENSG00000227155"; transcript_id "ENST00000628764"; exon_number "1"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu transcript 456204 470816 . - . gene_id "ENSG00000227155"; transcript_id "ENST00000593137"; NDR "NA"; txScore ""; txScore.noFit ""; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 456204 456703 . - . gene_id "ENSG00000227155"; transcript_id "ENST00000593137"; exon_number "4"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu transcript 456211 460227 . - . gene_id "ENSG00000227155"; transcript_id "ENST00000590240"; NDR "NA"; txScore ""; txScore.noFit ""; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 456211 456703 . - . gene_id "ENSG00000227155"; transcript_id "ENST00000590240"; exon_number "4"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu transcript 456518 467390 . - . gene_id "ENSG00000227155"; transcript_id "ENST00000592805"; NDR "NA"; txScore ""; txScore.noFit ""; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 456518 456703 . - . gene_id "ENSG00000227155"; transcript_id "ENST00000592805"; exon_number "2"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu transcript 456521 470934 . - . gene_id "ENSG00000227155"; transcript_id "ENST00000585819"; NDR "NA"; txScore ""; txScore.noFit ""; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 456521 456703 . - . gene_id "ENSG00000227155"; transcript_id "ENST00000585819"; exon_number "5"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu transcript 456530 466866 . - . gene_id "ENSG00000227155"; transcript_id "ENST00000588474"; NDR "NA"; txScore ""; txScore.noFit ""; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 456530 456703 . - . gene_id "ENSG00000227155"; transcript_id "ENST00000588474"; exon_number "5"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu transcript 456545 467336 . - . gene_id "ENSG00000227155"; transcript_id "ENST00000590518"; NDR "NA"; txScore ""; txScore.noFit ""; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 456545 456703 . - . gene_id "ENSG00000227155"; transcript_id "ENST00000590518"; exon_number "4"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 456915 457047 . - . gene_id "ENSG00000227155"; transcript_id "ENST00000585819"; exon_number "4"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 456915 457047 . - . gene_id "ENSG00000227155"; transcript_id "ENST00000588474"; exon_number "4"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 456915 457047 . - . gene_id "ENSG00000227155"; transcript_id "ENST00000590518"; exon_number "3"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 456915 457047 . - . gene_id "ENSG00000227155"; transcript_id "ENST00000593137"; exon_number "3"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu transcript 457004 467219 . - . gene_id "ENSG00000227155"; transcript_id "ENST00000588989"; NDR "NA"; txScore ""; txScore.noFit ""; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 457004 457047 . - . gene_id "ENSG00000227155"; transcript_id "ENST00000588989"; exon_number "4"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 458117 458281 . - . gene_id "ENSG00000227155"; transcript_id "ENST00000590240"; exon_number "3"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 458370 458423 . - . gene_id "ENSG00000227155"; transcript_id "ENST00000590240"; exon_number "2"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu transcript 459716 466065 . - . gene_id "ENSG00000227155"; transcript_id "ENST00000608617"; NDR "NA"; txScore ""; txScore.noFit ""; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 459716 460507 . - . gene_id "ENSG00000227155"; transcript_id "ENST00000585631"; exon_number "1"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 459716 459866 . - . gene_id "ENSG00000227155"; transcript_id "ENST00000585819"; exon_number "3"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 459716 459866 . - . gene_id "ENSG00000227155"; transcript_id "ENST00000588474"; exon_number "3"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 459716 459866 . - . gene_id "ENSG00000227155"; transcript_id "ENST00000588989"; exon_number "3"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 459716 460227 . - . gene_id "ENSG00000227155"; transcript_id "ENST00000590240"; exon_number "1"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 459716 459815 . - . gene_id "ENSG00000227155"; transcript_id "ENST00000608617"; exon_number "2"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 463517 463687 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000382329"; exon_number "34"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 463517 463687 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000432829"; exon_number "47"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 463517 463687 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000453981"; exon_number "46"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 463517 463687 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000469391"; exon_number "45"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 463517 463687 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000495184"; exon_number "45"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu transcript 463555 465247 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000462618"; NDR "NA"; txScore ""; txScore.noFit ""; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 463555 463687 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000462618"; exon_number "1"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 464159 465255 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000382329"; exon_number "35"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 464159 465259 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000432829"; exon_number "48"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 464159 465259 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000453981"; exon_number "47"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 464159 464278 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000462618"; exon_number "2"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 464159 464526 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000469391"; exon_number "46"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 464159 465241 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000495184"; exon_number "46"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 465073 465247 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000462618"; exon_number "3"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 465962 466069 . - . gene_id "ENSG00000227155"; transcript_id "ENST00000585819"; exon_number "2"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 465962 466069 . - . gene_id "ENSG00000227155"; transcript_id "ENST00000588474"; exon_number "2"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 465962 466069 . - . gene_id "ENSG00000227155"; transcript_id "ENST00000588989"; exon_number "2"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 465962 466069 . - . gene_id "ENSG00000227155"; transcript_id "ENST00000589387"; exon_number "2"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 465962 466069 . - . gene_id "ENSG00000227155"; transcript_id "ENST00000590518"; exon_number "2"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 465962 466069 . - . gene_id "ENSG00000227155"; transcript_id "ENST00000591577"; exon_number "2"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 465962 466069 . - . gene_id "ENSG00000227155"; transcript_id "ENST00000593137"; exon_number "2"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 465962 466065 . - . gene_id "ENSG00000227155"; transcript_id "ENST00000608617"; exon_number "1"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 466688 466866 . - . gene_id "ENSG00000227155"; transcript_id "ENST00000588474"; exon_number "1"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 466688 467219 . - . gene_id "ENSG00000227155"; transcript_id "ENST00000588989"; exon_number "1"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 466688 466853 . - . gene_id "ENSG00000227155"; transcript_id "ENST00000589287"; exon_number "2"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 466688 467390 . - . gene_id "ENSG00000227155"; transcript_id "ENST00000592805"; exon_number "1"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 466900 467336 . - . gene_id "ENSG00000227155"; transcript_id "ENST00000590518"; exon_number "1"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 469722 469802 . - . gene_id "ENSG00000227155"; transcript_id "ENST00000589287"; exon_number "1"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 469722 469802 . - . gene_id "ENSG00000227155"; transcript_id "ENST00000589387"; exon_number "1"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 469722 469836 . - . gene_id "ENSG00000227155"; transcript_id "ENST00000591577"; exon_number "1"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu transcript 470291 746105 . + . gene_id "ENSG00000107104"; transcript_id "ENST00000382303"; NDR "NA"; txScore ""; txScore.noFit ""; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 470291 470374 . + . gene_id "ENSG00000107104"; transcript_id "ENST00000382303"; exon_number "1"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 470556 470682 . + . gene_id "ENSG00000107104"; transcript_id "ENST00000382303"; exon_number "2"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu transcript 470592 484491 . + . gene_id "ENSG00000107104"; transcript_id "ENST00000467541"; NDR "NA"; txScore ""; txScore.noFit ""; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 470592 470677 . + . gene_id "ENSG00000107104"; transcript_id "ENST00000467541"; exon_number "1"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 470765 470934 . - . gene_id "ENSG00000227155"; transcript_id "ENST00000585819"; exon_number "1"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 470765 470961 . - . gene_id "ENSG00000227155"; transcript_id "ENST00000586805"; exon_number "1"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 470765 470816 . - . gene_id "ENSG00000227155"; transcript_id "ENST00000593137"; exon_number "1"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 471449 471586 . + . gene_id "ENSG00000107104"; transcript_id "ENST00000467541"; exon_number "2"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu transcript 471467 476769 . + . gene_id "ENSG00000107104"; transcript_id "ENST00000475690"; NDR "NA"; txScore ""; txScore.noFit ""; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 471467 471586 . + . gene_id "ENSG00000107104"; transcript_id "ENST00000475690"; exon_number "1"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 473194 473273 . + . gene_id "ENSG00000107104"; transcript_id "ENST00000382303"; exon_number "3"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 473194 473273 . + . gene_id "ENSG00000107104"; transcript_id "ENST00000467541"; exon_number "3"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 473194 473273 . + . gene_id "ENSG00000107104"; transcript_id "ENST00000475690"; exon_number "2"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 476628 476769 . + . gene_id "ENSG00000107104"; transcript_id "ENST00000475690"; exon_number "3"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu transcript 477750 478423 . + . gene_id "ENSG00000235330"; transcript_id "ENST00000598100"; NDR "NA"; txScore ""; txScore.noFit ""; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 477750 478423 . + . gene_id "ENSG00000235330"; transcript_id "ENST00000598100"; exon_number "1"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu transcript 477856 478349 . + . gene_id "ENSG00000235330"; transcript_id "ENST00000455592"; NDR "NA"; txScore ""; txScore.noFit ""; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 477856 478349 . + . gene_id "ENSG00000235330"; transcript_id "ENST00000455592"; exon_number "1"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 484282 484491 . + . gene_id "ENSG00000107104"; transcript_id "ENST00000467541"; exon_number "4"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu transcript 487774 495610 . + . gene_id "ENSG00000228115"; transcript_id "ENST00000442442"; NDR "NA"; txScore ""; txScore.noFit ""; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 487774 487803 . + . gene_id "ENSG00000228115"; transcript_id "ENST00000442442"; exon_number "1"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 488957 489066 . - . gene_id "ENSG00000227155"; transcript_id "ENST00000415004"; exon_number "2"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 492084 492248 . - . gene_id "ENSG00000227155"; transcript_id "ENST00000415004"; exon_number "1"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 495238 495610 . + . gene_id "ENSG00000228115"; transcript_id "ENST00000442442"; exon_number "2"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu transcript 504695 746106 . + . gene_id "ENSG00000107104"; transcript_id "ENST00000619269"; NDR "NA"; txScore ""; txScore.noFit ""; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 504695 504754 . + . gene_id "ENSG00000107104"; transcript_id "ENST00000619269"; exon_number "1"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu transcript 504702 746103 . + . gene_id "ENSG00000107104"; transcript_id "ENST00000489369"; NDR "NA"; txScore ""; txScore.noFit ""; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 504702 504754 . + . gene_id "ENSG00000107104"; transcript_id "ENST00000489369"; exon_number "1"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu transcript 504703 734129 . + . gene_id "ENSG00000107104"; transcript_id "ENST00000354485"; NDR "NA"; txScore ""; txScore.noFit ""; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 504703 504754 . + . gene_id "ENSG00000107104"; transcript_id "ENST00000354485"; exon_number "1"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu transcript 504716 746105 . + . gene_id "ENSG00000107104"; transcript_id "ENST00000382297"; NDR "NA"; txScore ""; txScore.noFit ""; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 504716 504754 . + . gene_id "ENSG00000107104"; transcript_id "ENST00000382297"; exon_number "1"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 539516 539633 . + . gene_id "ENSG00000107104"; transcript_id "ENST00000382303"; exon_number "4"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 540508 540667 . + . gene_id "ENSG00000107104"; transcript_id "ENST00000382303"; exon_number "5"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu transcript 547317 549531 . + . gene_id "ENSG00000226403"; transcript_id "ENST00000441028"; NDR "NA"; txScore ""; txScore.noFit ""; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 547317 547341 . + . gene_id "ENSG00000226403"; transcript_id "ENST00000441028"; exon_number "1"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu transcript 547318 549531 . + . gene_id "ENSG00000226403"; transcript_id "ENST00000444793"; NDR "NA"; txScore ""; txScore.noFit ""; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 547318 547341 . + . gene_id "ENSG00000226403"; transcript_id "ENST00000444793"; exon_number "1"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 549107 549531 . + . gene_id "ENSG00000226403"; transcript_id "ENST00000444793"; exon_number "2"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 549107 549721 . + . gene_id "ENSG00000107104"; transcript_id "ENST00000619269"; exon_number "2"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 549190 549531 . + . gene_id "ENSG00000226403"; transcript_id "ENST00000441028"; exon_number "2"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu transcript 558826 558930 . + . gene_id "ENSG00000202172"; transcript_id "ENST00000365302"; NDR "NA"; txScore ""; txScore.noFit ""; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 558826 558930 . + . gene_id "ENSG00000202172"; transcript_id "ENST00000365302"; exon_number "1"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu transcript 659986 660326 . + . gene_id "ENSG00000229875"; transcript_id "ENST00000421436"; NDR "NA"; txScore ""; txScore.noFit ""; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 659986 660326 . + . gene_id "ENSG00000229875"; transcript_id "ENST00000421436"; exon_number "1"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu transcript 673478 685555 . - . gene_id "ENSG00000227914"; transcript_id "ENST00000421645"; NDR "NA"; txScore ""; txScore.noFit ""; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 673478 674379 . - . gene_id "ENSG00000227914"; transcript_id "ENST00000421645"; exon_number "3"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu transcript 674124 677628 . - . gene_id "ENSG00000227914"; transcript_id "ENST00000608097"; NDR "NA"; txScore ""; txScore.noFit ""; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 674124 674379 . - . gene_id "ENSG00000227914"; transcript_id "ENST00000608097"; exon_number "2"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 676890 677009 . + . gene_id "ENSG00000107104"; transcript_id "ENST00000354485"; exon_number "2"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 676890 677009 . + . gene_id "ENSG00000107104"; transcript_id "ENST00000382297"; exon_number "2"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 676890 677009 . + . gene_id "ENSG00000107104"; transcript_id "ENST00000382303"; exon_number "6"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 676890 677009 . + . gene_id "ENSG00000107104"; transcript_id "ENST00000489369"; exon_number "2"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 676890 677009 . + . gene_id "ENSG00000107104"; transcript_id "ENST00000619269"; exon_number "3"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 677542 677628 . - . gene_id "ENSG00000227914"; transcript_id "ENST00000608097"; exon_number "1"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 680857 681046 . - . gene_id "ENSG00000227914"; transcript_id "ENST00000421645"; exon_number "2"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 685528 685555 . - . gene_id "ENSG00000227914"; transcript_id "ENST00000421645"; exon_number "1"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu transcript 706310 710955 . + . gene_id "ENSG00000107104"; transcript_id "BambuTx16"; NDR "1"; txScore ""; txScore.noFit ""; novelGene "FALSE"; novelTranscript "TRUE"; txClassDescription "compatible"; -9 Bambu exon 706310 707247 . + . gene_id "ENSG00000107104"; transcript_id "BambuTx16"; exon_number "1"; NDR "1"; maxTxScore "-1"; maxTxScore.noFit "-1"; novelGene "FALSE"; novelTranscript "TRUE"; txClassDescription "compatible"; -9 Bambu transcript 706746 712424 . + . gene_id "ENSG00000107104"; transcript_id "BambuTx17"; NDR "0.800639927387238"; txScore ""; txScore.noFit ""; novelGene "FALSE"; novelTranscript "TRUE"; txClassDescription "allNew"; -9 Bambu exon 706746 706830 . + . gene_id "ENSG00000107104"; transcript_id "BambuTx17"; exon_number "1"; NDR "0.800639927387238"; maxTxScore "0.199360072612762"; maxTxScore.noFit "0.199360072612762"; novelGene "FALSE"; novelTranscript "TRUE"; txClassDescription "allNew"; -9 Bambu transcript 706889 746103 . + . gene_id "ENSG00000107104"; transcript_id "ENST00000382293"; NDR "NA"; txScore ""; txScore.noFit ""; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 706889 707247 . + . gene_id "ENSG00000107104"; transcript_id "ENST00000382293"; exon_number "1"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 710804 713464 . + . gene_id "ENSG00000107104"; transcript_id "ENST00000354485"; exon_number "3"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 710804 713464 . + . gene_id "ENSG00000107104"; transcript_id "ENST00000382293"; exon_number "2"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 710804 713464 . + . gene_id "ENSG00000107104"; transcript_id "ENST00000382297"; exon_number "3"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 710804 713464 . + . gene_id "ENSG00000107104"; transcript_id "ENST00000382303"; exon_number "7"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 710804 713464 . + . gene_id "ENSG00000107104"; transcript_id "ENST00000489369"; exon_number "3"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 710804 713464 . + . gene_id "ENSG00000107104"; transcript_id "ENST00000619269"; exon_number "4"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 710804 710955 . + . gene_id "ENSG00000107104"; transcript_id "BambuTx16"; exon_number "2"; NDR "1"; maxTxScore "-1"; maxTxScore.noFit "-1"; novelGene "FALSE"; novelTranscript "TRUE"; txClassDescription "compatible"; -9 Bambu exon 710804 712424 . + . gene_id "ENSG00000107104"; transcript_id "BambuTx17"; exon_number "2"; NDR "0.800639927387238"; maxTxScore "0.199360072612762"; maxTxScore.noFit "0.199360072612762"; novelGene "FALSE"; novelTranscript "TRUE"; txClassDescription "allNew"; -9 Bambu transcript 713023 744747 . + . gene_id "ENSG00000107104"; transcript_id "BambuTx18"; NDR "1"; txScore ""; txScore.noFit ""; novelGene "FALSE"; novelTranscript "TRUE"; txClassDescription "compatible"; -9 Bambu exon 713023 713464 . + . gene_id "ENSG00000107104"; transcript_id "BambuTx18"; exon_number "1"; NDR "1"; maxTxScore "-1"; maxTxScore.noFit "-1"; novelGene "FALSE"; novelTranscript "TRUE"; txClassDescription "compatible"; -9 Bambu exon 730051 734129 . + . gene_id "ENSG00000107104"; transcript_id "ENST00000354485"; exon_number "4"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 730051 730248 . + . gene_id "ENSG00000107104"; transcript_id "ENST00000382293"; exon_number "3"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 730051 730248 . + . gene_id "ENSG00000107104"; transcript_id "ENST00000382297"; exon_number "4"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 730051 730248 . + . gene_id "ENSG00000107104"; transcript_id "ENST00000382303"; exon_number "8"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 730051 730248 . + . gene_id "ENSG00000107104"; transcript_id "ENST00000489369"; exon_number "4"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 730051 730248 . + . gene_id "ENSG00000107104"; transcript_id "ENST00000619269"; exon_number "5"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 730051 730248 . + . gene_id "ENSG00000107104"; transcript_id "BambuTx18"; exon_number "2"; NDR "1"; maxTxScore "-1"; maxTxScore.noFit "-1"; novelGene "FALSE"; novelTranscript "TRUE"; txClassDescription "compatible"; -9 Bambu exon 731158 731266 . + . gene_id "ENSG00000107104"; transcript_id "ENST00000382293"; exon_number "4"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 731158 731266 . + . gene_id "ENSG00000107104"; transcript_id "ENST00000382297"; exon_number "5"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 731158 731266 . + . gene_id "ENSG00000107104"; transcript_id "ENST00000382303"; exon_number "9"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 731158 731266 . + . gene_id "ENSG00000107104"; transcript_id "ENST00000489369"; exon_number "5"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 731158 731266 . + . gene_id "ENSG00000107104"; transcript_id "ENST00000619269"; exon_number "6"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 731158 731266 . + . gene_id "ENSG00000107104"; transcript_id "BambuTx18"; exon_number "3"; NDR "1"; maxTxScore "-1"; maxTxScore.noFit "-1"; novelGene "FALSE"; novelTranscript "TRUE"; txClassDescription "compatible"; -9 Bambu exon 732378 732617 . + . gene_id "ENSG00000107104"; transcript_id "ENST00000382293"; exon_number "5"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 732378 732617 . + . gene_id "ENSG00000107104"; transcript_id "ENST00000382297"; exon_number "6"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 732378 732617 . + . gene_id "ENSG00000107104"; transcript_id "ENST00000382303"; exon_number "10"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 732378 734835 . + . gene_id "ENSG00000107104"; transcript_id "ENST00000489369"; exon_number "6"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 732378 732617 . + . gene_id "ENSG00000107104"; transcript_id "ENST00000619269"; exon_number "7"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 732378 732617 . + . gene_id "ENSG00000107104"; transcript_id "BambuTx18"; exon_number "4"; NDR "1"; maxTxScore "-1"; maxTxScore.noFit "-1"; novelGene "FALSE"; novelTranscript "TRUE"; txClassDescription "compatible"; -9 Bambu transcript 732442 746102 . + . gene_id "ENSG00000107104"; transcript_id "ENST00000382289"; NDR "NA"; txScore ""; txScore.noFit ""; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 732442 732617 . + . gene_id "ENSG00000107104"; transcript_id "ENST00000382289"; exon_number "1"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu transcript 734748 746104 . + . gene_id "ENSG00000107104"; transcript_id "ENST00000382286"; NDR "NA"; txScore ""; txScore.noFit ""; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 734748 734835 . + . gene_id "ENSG00000107104"; transcript_id "ENST00000382286"; exon_number "1"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 734748 734835 . + . gene_id "ENSG00000107104"; transcript_id "ENST00000382289"; exon_number "2"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 734748 734835 . + . gene_id "ENSG00000107104"; transcript_id "ENST00000382293"; exon_number "6"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 734748 734835 . + . gene_id "ENSG00000107104"; transcript_id "ENST00000382297"; exon_number "7"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 734748 734835 . + . gene_id "ENSG00000107104"; transcript_id "ENST00000382303"; exon_number "11"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 734748 734835 . + . gene_id "ENSG00000107104"; transcript_id "ENST00000619269"; exon_number "8"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 734748 734835 . + . gene_id "ENSG00000107104"; transcript_id "BambuTx18"; exon_number "5"; NDR "1"; maxTxScore "-1"; maxTxScore.noFit "-1"; novelGene "FALSE"; novelTranscript "TRUE"; txClassDescription "compatible"; -9 Bambu exon 735712 735780 . + . gene_id "ENSG00000107104"; transcript_id "ENST00000382289"; exon_number "3"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 738285 738504 . + . gene_id "ENSG00000107104"; transcript_id "ENST00000382286"; exon_number "2"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 738285 738504 . + . gene_id "ENSG00000107104"; transcript_id "ENST00000382289"; exon_number "4"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 738285 738504 . + . gene_id "ENSG00000107104"; transcript_id "ENST00000382293"; exon_number "7"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 738285 738504 . + . gene_id "ENSG00000107104"; transcript_id "ENST00000382297"; exon_number "8"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 738285 738504 . + . gene_id "ENSG00000107104"; transcript_id "ENST00000382303"; exon_number "12"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 738285 738504 . + . gene_id "ENSG00000107104"; transcript_id "ENST00000489369"; exon_number "7"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 738285 738504 . + . gene_id "ENSG00000107104"; transcript_id "ENST00000619269"; exon_number "9"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 738285 738504 . + . gene_id "ENSG00000107104"; transcript_id "BambuTx18"; exon_number "6"; NDR "1"; maxTxScore "-1"; maxTxScore.noFit "-1"; novelGene "FALSE"; novelTranscript "TRUE"; txClassDescription "compatible"; -9 Bambu exon 740792 740934 . + . gene_id "ENSG00000107104"; transcript_id "ENST00000382286"; exon_number "3"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 740792 740934 . + . gene_id "ENSG00000107104"; transcript_id "ENST00000382289"; exon_number "5"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 740792 740934 . + . gene_id "ENSG00000107104"; transcript_id "ENST00000382293"; exon_number "8"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 740792 740934 . + . gene_id "ENSG00000107104"; transcript_id "ENST00000382297"; exon_number "9"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 740792 740934 . + . gene_id "ENSG00000107104"; transcript_id "ENST00000382303"; exon_number "13"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 740792 740934 . + . gene_id "ENSG00000107104"; transcript_id "ENST00000489369"; exon_number "8"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 740792 740934 . + . gene_id "ENSG00000107104"; transcript_id "ENST00000619269"; exon_number "10"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 740792 740934 . + . gene_id "ENSG00000107104"; transcript_id "BambuTx18"; exon_number "7"; NDR "1"; maxTxScore "-1"; maxTxScore.noFit "-1"; novelGene "FALSE"; novelTranscript "TRUE"; txClassDescription "compatible"; -9 Bambu exon 742205 742405 . + . gene_id "ENSG00000107104"; transcript_id "ENST00000382286"; exon_number "4"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 742205 742405 . + . gene_id "ENSG00000107104"; transcript_id "ENST00000382289"; exon_number "6"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 742205 742405 . + . gene_id "ENSG00000107104"; transcript_id "ENST00000382293"; exon_number "9"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 742205 742405 . + . gene_id "ENSG00000107104"; transcript_id "ENST00000382297"; exon_number "10"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 742205 742405 . + . gene_id "ENSG00000107104"; transcript_id "ENST00000382303"; exon_number "14"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 742205 742405 . + . gene_id "ENSG00000107104"; transcript_id "ENST00000489369"; exon_number "9"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 742205 742405 . + . gene_id "ENSG00000107104"; transcript_id "ENST00000619269"; exon_number "11"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 742205 742405 . + . gene_id "ENSG00000107104"; transcript_id "BambuTx18"; exon_number "8"; NDR "1"; maxTxScore "-1"; maxTxScore.noFit "-1"; novelGene "FALSE"; novelTranscript "TRUE"; txClassDescription "compatible"; -9 Bambu exon 744491 746104 . + . gene_id "ENSG00000107104"; transcript_id "ENST00000382286"; exon_number "5"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 744491 744589 . + . gene_id "ENSG00000107104"; transcript_id "ENST00000382289"; exon_number "7"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 744491 744589 . + . gene_id "ENSG00000107104"; transcript_id "ENST00000382293"; exon_number "10"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 744491 744589 . + . gene_id "ENSG00000107104"; transcript_id "ENST00000382297"; exon_number "11"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 744491 744589 . + . gene_id "ENSG00000107104"; transcript_id "ENST00000382303"; exon_number "15"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 744491 744589 . + . gene_id "ENSG00000107104"; transcript_id "ENST00000489369"; exon_number "10"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 744491 744589 . + . gene_id "ENSG00000107104"; transcript_id "ENST00000619269"; exon_number "12"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 744491 744747 . + . gene_id "ENSG00000107104"; transcript_id "BambuTx18"; exon_number "9"; NDR "1"; maxTxScore "-1"; maxTxScore.noFit "-1"; novelGene "FALSE"; novelTranscript "TRUE"; txClassDescription "compatible"; -9 Bambu exon 745173 746102 . + . gene_id "ENSG00000107104"; transcript_id "ENST00000382289"; exon_number "8"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 745173 746103 . + . gene_id "ENSG00000107104"; transcript_id "ENST00000382293"; exon_number "11"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 745173 746105 . + . gene_id "ENSG00000107104"; transcript_id "ENST00000382297"; exon_number "12"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 745173 746105 . + . gene_id "ENSG00000107104"; transcript_id "ENST00000382303"; exon_number "16"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 745173 746103 . + . gene_id "ENSG00000107104"; transcript_id "ENST00000489369"; exon_number "11"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 745173 746106 . + . gene_id "ENSG00000107104"; transcript_id "ENST00000619269"; exon_number "13"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu transcript 841690 969090 . + . gene_id "ENSG00000137090"; transcript_id "ENST00000382276"; NDR "NA"; txScore ""; txScore.noFit ""; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu transcript 841690 894985 . + . gene_id "ENSG00000137090"; transcript_id "ENST00000564322"; NDR "NA"; txScore ""; txScore.noFit ""; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 841690 842192 . + . gene_id "ENSG00000137090"; transcript_id "ENST00000382276"; exon_number "1"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 841690 842192 . + . gene_id "ENSG00000137090"; transcript_id "ENST00000564322"; exon_number "1"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu transcript 842714 968515 . + . gene_id "ENSG00000137090"; transcript_id "ENST00000569227"; NDR "NA"; txScore ""; txScore.noFit ""; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 842714 842954 . + . gene_id "ENSG00000137090"; transcript_id "ENST00000569227"; exon_number "1"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 846960 847143 . + . gene_id "ENSG00000137090"; transcript_id "ENST00000382276"; exon_number "2"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 846960 847143 . + . gene_id "ENSG00000137090"; transcript_id "ENST00000564322"; exon_number "2"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 846960 847143 . + . gene_id "ENSG00000137090"; transcript_id "ENST00000569227"; exon_number "2"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 893912 894195 . + . gene_id "ENSG00000137090"; transcript_id "ENST00000382276"; exon_number "3"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 893912 894985 . + . gene_id "ENSG00000137090"; transcript_id "ENST00000564322"; exon_number "3"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 893912 894195 . + . gene_id "ENSG00000137090"; transcript_id "ENST00000569227"; exon_number "3"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 916763 916907 . + . gene_id "ENSG00000137090"; transcript_id "ENST00000382276"; exon_number "4"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 916763 916907 . + . gene_id "ENSG00000137090"; transcript_id "ENST00000569227"; exon_number "4"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 967985 969090 . + . gene_id "ENSG00000137090"; transcript_id "ENST00000382276"; exon_number "5"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 967985 968515 . + . gene_id "ENSG00000137090"; transcript_id "ENST00000569227"; exon_number "5"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu transcript 976964 991731 . + . gene_id "ENSG00000064218"; transcript_id "ENST00000190165"; NDR "NA"; txScore ""; txScore.noFit ""; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 976964 977455 . + . gene_id "ENSG00000064218"; transcript_id "ENST00000190165"; exon_number "1"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu transcript 989837 990333 . + . gene_id "ENSG00000064218"; transcript_id "ENST00000417254"; NDR "NA"; txScore ""; txScore.noFit ""; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 989837 990333 . + . gene_id "ENSG00000064218"; transcript_id "ENST00000417254"; exon_number "1"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 990041 991731 . + . gene_id "ENSG00000064218"; transcript_id "ENST00000190165"; exon_number "2"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; diff --git a/output/combined_extended_annotations_extendedAnnotations.gtf b/output/combined_extended_annotations_extendedAnnotations.gtf deleted file mode 100644 index 031e48b..0000000 --- a/output/combined_extended_annotations_extendedAnnotations.gtf +++ /dev/null @@ -1,936 +0,0 @@ -9 Bambu transcript 12134 13783 . + . gene_id "ENSG00000236875"; transcript_id "ENST00000421620"; NDR "NA"; txScore ""; txScore.noFit ""; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 12134 12190 . + . gene_id "ENSG00000236875"; transcript_id "ENST00000421620"; exon_number "1"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 12291 12340 . + . gene_id "ENSG00000236875"; transcript_id "ENST00000421620"; exon_number "2"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 12726 12834 . + . gene_id "ENSG00000236875"; transcript_id "ENST00000421620"; exon_number "3"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 13088 13157 . + . gene_id "ENSG00000236875"; transcript_id "ENST00000421620"; exon_number "4"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 13338 13487 . + . gene_id "ENSG00000236875"; transcript_id "ENST00000421620"; exon_number "5"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 13566 13783 . + . gene_id "ENSG00000236875"; transcript_id "ENST00000421620"; exon_number "6"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu transcript 14521 29739 . - . gene_id "ENSG00000181404"; transcript_id "ENST00000442898"; NDR "NA"; txScore ""; txScore.noFit ""; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 14521 14940 . - . gene_id "ENSG00000181404"; transcript_id "ENST00000442898"; exon_number "11"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 15081 15149 . - . gene_id "ENSG00000181404"; transcript_id "ENST00000442898"; exon_number "10"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 15909 16061 . - . gene_id "ENSG00000181404"; transcript_id "ENST00000442898"; exon_number "9"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 16718 16876 . - . gene_id "ENSG00000181404"; transcript_id "ENST00000442898"; exon_number "8"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 16965 17166 . - . gene_id "ENSG00000181404"; transcript_id "ENST00000442898"; exon_number "7"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 17344 17479 . - . gene_id "ENSG00000181404"; transcript_id "ENST00000442898"; exon_number "6"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 17719 17855 . - . gene_id "ENSG00000181404"; transcript_id "ENST00000442898"; exon_number "5"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 18028 18174 . - . gene_id "ENSG00000181404"; transcript_id "ENST00000442898"; exon_number "4"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 18381 18492 . - . gene_id "ENSG00000181404"; transcript_id "ENST00000442898"; exon_number "3"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 24851 25004 . - . gene_id "ENSG00000181404"; transcript_id "ENST00000442898"; exon_number "2"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu transcript 27657 30891 . + . gene_id "ENSG00000227518"; transcript_id "ENST00000422679"; NDR "NA"; txScore ""; txScore.noFit ""; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 27657 30445 . + . gene_id "ENSG00000227518"; transcript_id "ENST00000422679"; exon_number "1"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 29602 29739 . - . gene_id "ENSG00000181404"; transcript_id "ENST00000442898"; exon_number "1"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu transcript 30144 30281 . + . gene_id "ENSG00000283921"; transcript_id "ENST00000408365"; NDR "NA"; txScore ""; txScore.noFit ""; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 30144 30281 . + . gene_id "ENSG00000283921"; transcript_id "ENST00000408365"; exon_number "1"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 30758 30891 . + . gene_id "ENSG00000227518"; transcript_id "ENST00000422679"; exon_number "2"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu transcript 34394 35860 . - . gene_id "ENSG00000218839"; transcript_id "ENST00000449442"; NDR "NA"; txScore ""; txScore.noFit ""; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 34394 34957 . - . gene_id "ENSG00000218839"; transcript_id "ENST00000449442"; exon_number "3"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu transcript 34965 35871 . - . gene_id "ENSG00000218839"; transcript_id "ENST00000305248"; NDR "NA"; txScore ""; txScore.noFit ""; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 34965 35264 . - . gene_id "ENSG00000218839"; transcript_id "ENST00000305248"; exon_number "2"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 35060 35264 . - . gene_id "ENSG00000218839"; transcript_id "ENST00000449442"; exon_number "2"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 35504 35871 . - . gene_id "ENSG00000218839"; transcript_id "ENST00000305248"; exon_number "1"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 35504 35860 . - . gene_id "ENSG00000218839"; transcript_id "ENST00000449442"; exon_number "1"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu transcript 72674 87667 . + . gene_id "ENSG00000277631"; transcript_id "ENST00000621255"; NDR "NA"; txScore ""; txScore.noFit ""; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 72674 72816 . + . gene_id "ENSG00000277631"; transcript_id "ENST00000621255"; exon_number "1"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu transcript 72675 75293 . + . gene_id "ENSG00000277631"; transcript_id "ENST00000620326"; NDR "NA"; txScore ""; txScore.noFit ""; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 72675 72816 . + . gene_id "ENSG00000277631"; transcript_id "ENST00000620326"; exon_number "1"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu transcript 72691 88826 . + . gene_id "ENSG00000277631"; transcript_id "ENST00000429980"; NDR "NA"; txScore ""; txScore.noFit ""; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 72691 72816 . + . gene_id "ENSG00000277631"; transcript_id "ENST00000429980"; exon_number "1"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu transcript 72705 75327 . + . gene_id "ENSG00000277631"; transcript_id "ENST00000442069"; NDR "NA"; txScore ""; txScore.noFit ""; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 72705 72816 . + . gene_id "ENSG00000277631"; transcript_id "ENST00000442069"; exon_number "1"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu transcript 72727 87739 . + . gene_id "ENSG00000277631"; transcript_id "ENST00000613372"; NDR "NA"; txScore ""; txScore.noFit ""; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 72727 72816 . + . gene_id "ENSG00000277631"; transcript_id "ENST00000613372"; exon_number "1"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu transcript 74139 87590 . + . gene_id "ENSG00000277631"; transcript_id "ENST00000622412"; NDR "NA"; txScore ""; txScore.noFit ""; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 74139 74205 . + . gene_id "ENSG00000277631"; transcript_id "ENST00000622412"; exon_number "1"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 74149 74205 . + . gene_id "ENSG00000277631"; transcript_id "ENST00000442069"; exon_number "2"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 74882 75327 . + . gene_id "ENSG00000277631"; transcript_id "ENST00000442069"; exon_number "3"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 74882 75293 . + . gene_id "ENSG00000277631"; transcript_id "ENST00000620326"; exon_number "2"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 79345 79537 . + . gene_id "ENSG00000277631"; transcript_id "ENST00000429980"; exon_number "2"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 79345 79537 . + . gene_id "ENSG00000277631"; transcript_id "ENST00000613372"; exon_number "2"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 79345 79537 . + . gene_id "ENSG00000277631"; transcript_id "ENST00000621255"; exon_number "2"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 79345 79537 . + . gene_id "ENSG00000277631"; transcript_id "ENST00000622412"; exon_number "2"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 80651 80807 . + . gene_id "ENSG00000277631"; transcript_id "ENST00000621255"; exon_number "3"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 87284 87739 . + . gene_id "ENSG00000277631"; transcript_id "ENST00000613372"; exon_number "3"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 87284 87667 . + . gene_id "ENSG00000277631"; transcript_id "ENST00000621255"; exon_number "4"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 87284 87590 . + . gene_id "ENSG00000277631"; transcript_id "ENST00000622412"; exon_number "3"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu transcript 87661 88775 . + . gene_id "ENSG00000277631"; transcript_id "ENST00000614900"; NDR "NA"; txScore ""; txScore.noFit ""; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 87661 88195 . + . gene_id "ENSG00000277631"; transcript_id "ENST00000614900"; exon_number "1"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 88742 88826 . + . gene_id "ENSG00000277631"; transcript_id "ENST00000429980"; exon_number "3"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 88742 88775 . + . gene_id "ENSG00000277631"; transcript_id "ENST00000614900"; exon_number "2"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu transcript 100804 102850 . - . gene_id "ENSG00000227917"; transcript_id "ENST00000435421"; NDR "NA"; txScore ""; txScore.noFit ""; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 100804 101304 . - . gene_id "ENSG00000227917"; transcript_id "ENST00000435421"; exon_number "2"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu transcript 100994 102941 . - . gene_id "ENSG00000227917"; transcript_id "ENST00000427318"; NDR "NA"; txScore ""; txScore.noFit ""; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 100994 101304 . - . gene_id "ENSG00000227917"; transcript_id "ENST00000427318"; exon_number "3"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 102473 102541 . - . gene_id "ENSG00000227917"; transcript_id "ENST00000427318"; exon_number "2"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 102740 102941 . - . gene_id "ENSG00000227917"; transcript_id "ENST00000427318"; exon_number "1"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 102740 102850 . - . gene_id "ENSG00000227917"; transcript_id "ENST00000435421"; exon_number "1"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu transcript 112713 113754 . - . gene_id "ENSG00000231808"; transcript_id "ENST00000416242"; NDR "NA"; txScore ""; txScore.noFit ""; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 112713 113067 . - . gene_id "ENSG00000231808"; transcript_id "ENST00000416242"; exon_number "2"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 113694 113754 . - . gene_id "ENSG00000231808"; transcript_id "ENST00000416242"; exon_number "1"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu transcript 116231 118204 . - . gene_id "ENSG00000170122"; transcript_id "ENST00000382500"; NDR "NA"; txScore ""; txScore.noFit ""; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 116231 118204 . - . gene_id "ENSG00000170122"; transcript_id "ENST00000382500"; exon_number "1"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu transcript 121038 179058 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000356521"; NDR "0.790184378623962"; txScore ""; txScore.noFit ""; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 121038 121573 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000356521"; exon_number "15"; NDR "0.790184378623962"; maxTxScore "0.209815621376038"; maxTxScore.noFit "0.209815621376038"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu transcript 121041 179147 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000377400"; NDR "NA"; txScore ""; txScore.noFit ""; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 121041 121573 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000377400"; exon_number "15"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu transcript 121052 146140 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000475990"; NDR "NA"; txScore ""; txScore.noFit ""; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 121052 123282 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000475990"; exon_number "4"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu transcript 121058 164009 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000619157"; NDR "NA"; txScore ""; txScore.noFit ""; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 121058 121573 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000619157"; exon_number "12"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu transcript 121060 179047 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000314367"; NDR "NA"; txScore ""; txScore.noFit ""; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 121060 121573 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000314367"; exon_number "16"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu transcript 121089 149446 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000475411"; NDR "NA"; txScore ""; txScore.noFit ""; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu transcript 121089 179012 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000612045"; NDR "NA"; txScore ""; txScore.noFit ""; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 121089 122090 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000475411"; exon_number "5"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 121089 121573 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000612045"; exon_number "16"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu transcript 121091 148625 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000611457"; NDR "NA"; txScore ""; txScore.noFit ""; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 121091 121573 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000611457"; exon_number "6"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu transcript 121224 179042 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000465014"; NDR "NA"; txScore ""; txScore.noFit ""; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 121224 121573 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000465014"; exon_number "15"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu transcript 121407 179008 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000613508"; NDR "NA"; txScore ""; txScore.noFit ""; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 121407 121573 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000613508"; exon_number "13"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu transcript 121409 179021 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000382447"; NDR "1"; txScore ""; txScore.noFit ""; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 121409 121573 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000382447"; exon_number "14"; NDR "1"; maxTxScore "-1"; maxTxScore.noFit "-1"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu transcript 121410 166599 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000487575"; NDR "NA"; txScore ""; txScore.noFit ""; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 121410 121573 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000487575"; exon_number "15"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu transcript 121411 123747 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000464198"; NDR "NA"; txScore ""; txScore.noFit ""; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 121411 121573 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000464198"; exon_number "4"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu transcript 121418 167605 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000495302"; NDR "NA"; txScore ""; txScore.noFit ""; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 121418 121573 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000495302"; exon_number "13"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu transcript 121503 146154 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000462513"; NDR "NA"; txScore ""; txScore.noFit ""; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 121503 121573 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000462513"; exon_number "6"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 121961 122090 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000314367"; exon_number "15"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 121961 122090 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000356521"; exon_number "14"; NDR "0.790184378623962"; maxTxScore "0.209815621376038"; maxTxScore.noFit "0.209815621376038"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 121961 122090 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000377400"; exon_number "14"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 121961 122090 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000382447"; exon_number "13"; NDR "1"; maxTxScore "-1"; maxTxScore.noFit "-1"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 121961 122136 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000462513"; exon_number "5"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 121961 122090 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000464198"; exon_number "3"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 121961 122090 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000465014"; exon_number "14"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 121961 122090 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000487575"; exon_number "14"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 121961 122090 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000495302"; exon_number "12"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 121961 122090 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000611457"; exon_number "5"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 121961 122090 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000612045"; exon_number "15"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 121961 122090 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000613508"; exon_number "12"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 121961 122090 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000619157"; exon_number "11"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu transcript 122691 179052 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000616944"; NDR "NA"; txScore ""; txScore.noFit ""; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 122691 123282 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000616944"; exon_number "14"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu transcript 122843 179016 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000613355"; NDR "NA"; txScore ""; txScore.noFit ""; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 122843 123282 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000613355"; exon_number "13"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 123217 123282 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000314367"; exon_number "14"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 123217 123282 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000356521"; exon_number "13"; NDR "0.790184378623962"; maxTxScore "0.209815621376038"; maxTxScore.noFit "0.209815621376038"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 123217 123282 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000377400"; exon_number "13"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 123217 123282 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000382447"; exon_number "12"; NDR "1"; maxTxScore "-1"; maxTxScore.noFit "-1"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 123217 123282 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000462513"; exon_number "4"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 123217 123282 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000464198"; exon_number "2"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 123217 123282 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000465014"; exon_number "13"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 123217 123282 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000475411"; exon_number "4"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 123217 123282 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000487575"; exon_number "13"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 123217 123282 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000495302"; exon_number "11"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 123217 123282 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000611457"; exon_number "4"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 123217 123282 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000612045"; exon_number "14"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 123217 123282 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000613508"; exon_number "11"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 123217 123282 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000619157"; exon_number "10"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 123386 123454 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000314367"; exon_number "13"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 123386 123454 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000356521"; exon_number "12"; NDR "0.790184378623962"; maxTxScore "0.209815621376038"; maxTxScore.noFit "0.209815621376038"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 123386 123454 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000377400"; exon_number "12"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 123386 123454 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000382447"; exon_number "11"; NDR "1"; maxTxScore "-1"; maxTxScore.noFit "-1"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 123386 123454 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000462513"; exon_number "3"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 123386 123747 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000464198"; exon_number "1"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 123386 123454 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000465014"; exon_number "12"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 123386 123454 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000475411"; exon_number "3"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 123386 123454 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000475990"; exon_number "3"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 123386 123454 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000487575"; exon_number "12"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 123386 123454 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000495302"; exon_number "10"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 123386 123454 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000611457"; exon_number "3"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 123386 123454 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000612045"; exon_number "13"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 123386 123454 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000613355"; exon_number "12"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 123386 123454 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000613508"; exon_number "10"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 123386 123454 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000616944"; exon_number "13"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 123386 123454 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000619157"; exon_number "9"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 134979 135030 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000314367"; exon_number "12"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 134979 135030 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000356521"; exon_number "11"; NDR "0.790184378623962"; maxTxScore "0.209815621376038"; maxTxScore.noFit "0.209815621376038"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 134979 135030 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000377400"; exon_number "11"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 134979 135030 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000382447"; exon_number "10"; NDR "1"; maxTxScore "-1"; maxTxScore.noFit "-1"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 134979 135030 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000462513"; exon_number "2"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 134979 135030 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000465014"; exon_number "11"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 134979 135030 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000475411"; exon_number "2"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 134979 135030 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000475990"; exon_number "2"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 134979 135030 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000487575"; exon_number "11"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 134979 135030 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000495302"; exon_number "9"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 134979 135030 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000611457"; exon_number "2"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 134979 135030 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000612045"; exon_number "12"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 134979 135030 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000613355"; exon_number "11"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 134979 135030 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000613508"; exon_number "9"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 134979 135030 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000616944"; exon_number "12"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 134979 135030 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000619157"; exon_number "8"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 146102 146158 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000314367"; exon_number "11"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 146102 146158 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000356521"; exon_number "10"; NDR "0.790184378623962"; maxTxScore "0.209815621376038"; maxTxScore.noFit "0.209815621376038"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 146102 146158 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000377400"; exon_number "10"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 146102 146154 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000462513"; exon_number "1"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 146102 146158 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000465014"; exon_number "10"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 146102 149446 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000475411"; exon_number "1"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 146102 146140 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000475990"; exon_number "1"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 146102 146158 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000487575"; exon_number "10"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 146102 146158 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000495302"; exon_number "8"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 146102 148625 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000611457"; exon_number "1"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 146102 146158 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000612045"; exon_number "11"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 146102 146158 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000616944"; exon_number "11"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 146102 146158 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000619157"; exon_number "7"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu transcript 146114 172172 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000498044"; NDR "NA"; txScore ""; txScore.noFit ""; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 146114 146158 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000498044"; exon_number "9"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 147901 148040 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000465014"; exon_number "9"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu transcript 147950 164039 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000618361"; NDR "NA"; txScore ""; txScore.noFit ""; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 147950 148044 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000618361"; exon_number "8"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu transcript 150132 164039 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000618061"; NDR "NA"; txScore ""; txScore.noFit ""; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 150132 152078 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000618061"; exon_number "5"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 150509 150725 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000487575"; exon_number "9"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 150642 150725 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000498044"; exon_number "8"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 151305 151427 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000495302"; exon_number "7"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 151305 151427 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000612045"; exon_number "10"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 151305 151427 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000618361"; exon_number "7"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu transcript 151577 179088 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000613988"; NDR "NA"; txScore ""; txScore.noFit ""; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 151577 152078 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000613988"; exon_number "10"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu transcript 151745 161647 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000489272"; NDR "NA"; txScore ""; txScore.noFit ""; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 151745 152078 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000489272"; exon_number "4"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu transcript 152034 173325 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000616803"; NDR "NA"; txScore ""; txScore.noFit ""; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 152034 152078 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000314367"; exon_number "10"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 152034 152078 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000356521"; exon_number "9"; NDR "0.790184378623962"; maxTxScore "0.209815621376038"; maxTxScore.noFit "0.209815621376038"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 152034 152078 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000377400"; exon_number "9"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 152034 152078 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000382447"; exon_number "9"; NDR "1"; maxTxScore "-1"; maxTxScore.noFit "-1"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 152034 152078 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000465014"; exon_number "8"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 152034 152078 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000487575"; exon_number "8"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 152034 152078 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000495302"; exon_number "6"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 152034 152078 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000498044"; exon_number "7"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 152034 152078 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000612045"; exon_number "9"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 152034 152078 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000613355"; exon_number "10"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 152034 152078 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000613508"; exon_number "8"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 152034 152078 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000616803"; exon_number "8"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 152034 152078 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000616944"; exon_number "10"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 152034 152078 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000618361"; exon_number "6"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 152034 152078 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000619157"; exon_number "6"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu transcript 152914 179025 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000377447"; NDR "0.653861284255981"; txScore ""; txScore.noFit ""; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 152914 154795 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000377447"; exon_number "8"; NDR "0.653861284255981"; maxTxScore "0.346138715744019"; maxTxScore.noFit "0.346138715744019"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 154709 154795 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000314367"; exon_number "9"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 154709 154795 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000356521"; exon_number "8"; NDR "0.790184378623962"; maxTxScore "0.209815621376038"; maxTxScore.noFit "0.209815621376038"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 154709 154795 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000377400"; exon_number "8"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 154709 154795 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000382447"; exon_number "8"; NDR "1"; maxTxScore "-1"; maxTxScore.noFit "-1"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 154709 154795 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000487575"; exon_number "7"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 154709 154795 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000489272"; exon_number "3"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 154709 154795 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000495302"; exon_number "5"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 154709 154795 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000498044"; exon_number "6"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 154709 154795 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000613355"; exon_number "9"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 154709 154795 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000613988"; exon_number "9"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 154709 154795 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000616803"; exon_number "7"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 154709 154795 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000616944"; exon_number "9"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 154709 154795 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000618361"; exon_number "5"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 154709 154795 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000619157"; exon_number "5"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu transcript 154732 172179 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000620292"; NDR "NA"; txScore ""; txScore.noFit ""; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 154732 154795 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000620292"; exon_number "6"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 156481 156527 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000314367"; exon_number "8"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 156481 156527 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000356521"; exon_number "7"; NDR "0.790184378623962"; maxTxScore "0.209815621376038"; maxTxScore.noFit "0.209815621376038"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 156481 156527 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000377400"; exon_number "7"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 156481 156527 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000377447"; exon_number "7"; NDR "0.653861284255981"; maxTxScore "0.346138715744019"; maxTxScore.noFit "0.346138715744019"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 156481 156527 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000382447"; exon_number "7"; NDR "1"; maxTxScore "-1"; maxTxScore.noFit "-1"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 156481 156527 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000465014"; exon_number "7"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 156481 156527 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000487575"; exon_number "6"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 156481 156527 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000489272"; exon_number "2"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 156481 156527 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000495302"; exon_number "4"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 156481 156527 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000498044"; exon_number "5"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 156481 156527 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000612045"; exon_number "8"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 156481 156527 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000613355"; exon_number "8"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 156481 156527 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000613508"; exon_number "7"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 156481 156527 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000613988"; exon_number "8"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 156481 156527 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000616803"; exon_number "6"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 156481 156527 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000616944"; exon_number "8"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 156481 156527 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000618061"; exon_number "4"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 156481 156527 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000618361"; exon_number "4"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 156481 156527 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000619157"; exon_number "4"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 156481 156527 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000620292"; exon_number "5"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 160001 160140 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000487575"; exon_number "5"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 160001 160140 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000498044"; exon_number "4"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 160001 160140 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000612045"; exon_number "7"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 160001 160140 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000620292"; exon_number "4"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu transcript 160088 179018 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000431099"; NDR "NA"; txScore ""; txScore.noFit ""; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 160088 160140 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000431099"; exon_number "8"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 161567 161654 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000465014"; exon_number "6"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 161567 161654 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000487575"; exon_number "4"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 161567 161647 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000489272"; exon_number "1"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 161567 161654 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000612045"; exon_number "6"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 161567 161654 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000616803"; exon_number "5"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 161567 161654 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000616944"; exon_number "7"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 161567 161654 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000618061"; exon_number "3"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 161567 161654 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000618361"; exon_number "3"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 161567 161654 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000619157"; exon_number "3"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 162432 162469 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000314367"; exon_number "7"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 162432 162469 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000356521"; exon_number "6"; NDR "0.790184378623962"; maxTxScore "0.209815621376038"; maxTxScore.noFit "0.209815621376038"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 162432 162469 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000377400"; exon_number "6"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 162432 162469 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000377447"; exon_number "6"; NDR "0.653861284255981"; maxTxScore "0.346138715744019"; maxTxScore.noFit "0.346138715744019"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 162432 162469 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000382447"; exon_number "6"; NDR "1"; maxTxScore "-1"; maxTxScore.noFit "-1"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 162432 162469 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000431099"; exon_number "7"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 162432 162469 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000465014"; exon_number "5"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 162432 162469 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000487575"; exon_number "3"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 162432 162469 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000495302"; exon_number "3"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 162432 162469 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000498044"; exon_number "3"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 162432 162469 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000612045"; exon_number "5"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 162432 162469 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000613355"; exon_number "7"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 162432 162469 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000613508"; exon_number "6"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 162432 162469 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000613988"; exon_number "7"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 162432 162469 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000616803"; exon_number "4"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 162432 162469 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000616944"; exon_number "6"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 162432 162469 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000618061"; exon_number "2"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 162432 162469 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000618361"; exon_number "2"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 162432 162469 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000619157"; exon_number "2"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 162432 162469 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000620292"; exon_number "3"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 163978 164037 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000314367"; exon_number "6"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 163978 164037 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000356521"; exon_number "5"; NDR "0.790184378623962"; maxTxScore "0.209815621376038"; maxTxScore.noFit "0.209815621376038"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 163978 164037 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000377400"; exon_number "5"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 163978 164037 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000377447"; exon_number "5"; NDR "0.653861284255981"; maxTxScore "0.346138715744019"; maxTxScore.noFit "0.346138715744019"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 163978 164037 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000382447"; exon_number "5"; NDR "1"; maxTxScore "-1"; maxTxScore.noFit "-1"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 163978 164037 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000431099"; exon_number "6"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 163978 164037 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000487575"; exon_number "2"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 163978 164037 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000495302"; exon_number "2"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 163978 164037 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000498044"; exon_number "2"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 163978 164037 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000613355"; exon_number "6"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 163978 164037 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000613508"; exon_number "5"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 163978 164037 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000613988"; exon_number "6"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 163978 164037 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000616944"; exon_number "5"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 163978 164039 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000618061"; exon_number "1"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 163978 164039 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000618361"; exon_number "1"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 163978 164009 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000619157"; exon_number "1"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 163978 164037 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000620292"; exon_number "2"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 164403 164448 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000616803"; exon_number "3"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 165983 166599 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000487575"; exon_number "1"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 165983 167605 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000495302"; exon_number "1"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu transcript 171596 173371 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000483817"; NDR "NA"; txScore ""; txScore.noFit ""; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 171596 172172 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000483817"; exon_number "2"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu transcript 171953 179023 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000382389"; NDR "1"; txScore ""; txScore.noFit ""; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu transcript 171953 179045 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000382393"; NDR "0.281998038291931"; txScore ""; txScore.noFit ""; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 171953 173366 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000382389"; exon_number "4"; NDR "1"; maxTxScore "-1"; maxTxScore.noFit "-1"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 171953 173366 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000382393"; exon_number "3"; NDR "0.281998038291931"; maxTxScore "0.718001961708069"; maxTxScore.noFit "0.718001961708069"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 172081 172172 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000314367"; exon_number "5"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 172081 172172 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000356521"; exon_number "4"; NDR "0.790184378623962"; maxTxScore "0.209815621376038"; maxTxScore.noFit "0.209815621376038"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 172081 172172 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000377400"; exon_number "4"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 172081 172172 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000377447"; exon_number "4"; NDR "0.653861284255981"; maxTxScore "0.346138715744019"; maxTxScore.noFit "0.346138715744019"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 172081 172172 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000382447"; exon_number "4"; NDR "1"; maxTxScore "-1"; maxTxScore.noFit "-1"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 172081 172172 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000431099"; exon_number "5"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 172081 172172 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000465014"; exon_number "4"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 172081 172172 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000498044"; exon_number "1"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 172081 172172 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000612045"; exon_number "4"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 172081 172172 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000613355"; exon_number "5"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 172081 172172 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000613508"; exon_number "4"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 172081 172172 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000613988"; exon_number "5"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 172081 172172 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000616803"; exon_number "2"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 172081 172172 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000616944"; exon_number "4"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 172081 172179 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000620292"; exon_number "1"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 173270 173366 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000314367"; exon_number "4"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 173270 173366 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000356521"; exon_number "3"; NDR "0.790184378623962"; maxTxScore "0.209815621376038"; maxTxScore.noFit "0.209815621376038"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 173270 173366 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000377400"; exon_number "3"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 173270 173366 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000377447"; exon_number "3"; NDR "0.653861284255981"; maxTxScore "0.346138715744019"; maxTxScore.noFit "0.346138715744019"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 173270 173366 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000382447"; exon_number "3"; NDR "1"; maxTxScore "-1"; maxTxScore.noFit "-1"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 173270 173366 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000431099"; exon_number "4"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 173270 173366 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000465014"; exon_number "3"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 173270 173371 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000483817"; exon_number "1"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 173270 173366 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000612045"; exon_number "3"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 173270 173366 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000613355"; exon_number "4"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 173270 173366 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000613508"; exon_number "3"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 173270 173366 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000613988"; exon_number "4"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 173270 173325 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000616803"; exon_number "1"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 173270 173366 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000616944"; exon_number "3"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 175698 175784 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000314367"; exon_number "3"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 175698 175784 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000356521"; exon_number "2"; NDR "0.790184378623962"; maxTxScore "0.209815621376038"; maxTxScore.noFit "0.209815621376038"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 175698 175784 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000377400"; exon_number "2"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 175698 175784 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000377447"; exon_number "2"; NDR "0.653861284255981"; maxTxScore "0.346138715744019"; maxTxScore.noFit "0.346138715744019"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 175698 175784 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000382389"; exon_number "3"; NDR "1"; maxTxScore "-1"; maxTxScore.noFit "-1"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 175698 175784 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000382393"; exon_number "2"; NDR "0.281998038291931"; maxTxScore "0.718001961708069"; maxTxScore.noFit "0.718001961708069"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 175698 175784 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000382447"; exon_number "2"; NDR "1"; maxTxScore "-1"; maxTxScore.noFit "-1"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 175698 175784 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000431099"; exon_number "3"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 175698 175784 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000465014"; exon_number "2"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 175698 175784 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000612045"; exon_number "2"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 175698 175784 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000613355"; exon_number "3"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 175698 175784 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000613508"; exon_number "2"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 175698 175784 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000613988"; exon_number "3"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 175698 175784 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000616944"; exon_number "2"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 177723 177820 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000314367"; exon_number "2"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 177723 177820 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000382389"; exon_number "2"; NDR "1"; maxTxScore "-1"; maxTxScore.noFit "-1"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 177723 177820 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000431099"; exon_number "2"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 177723 177820 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000613355"; exon_number "2"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 177723 177820 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000613988"; exon_number "2"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 178816 179047 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000314367"; exon_number "1"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 178816 179058 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000356521"; exon_number "1"; NDR "0.790184378623962"; maxTxScore "0.209815621376038"; maxTxScore.noFit "0.209815621376038"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 178816 179147 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000377400"; exon_number "1"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 178816 179025 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000377447"; exon_number "1"; NDR "0.653861284255981"; maxTxScore "0.346138715744019"; maxTxScore.noFit "0.346138715744019"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 178816 179023 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000382389"; exon_number "1"; NDR "1"; maxTxScore "-1"; maxTxScore.noFit "-1"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 178816 179045 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000382393"; exon_number "1"; NDR "0.281998038291931"; maxTxScore "0.718001961708069"; maxTxScore.noFit "0.718001961708069"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 178816 179021 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000382447"; exon_number "1"; NDR "1"; maxTxScore "-1"; maxTxScore.noFit "-1"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 178816 179018 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000431099"; exon_number "1"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 178816 179042 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000465014"; exon_number "1"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 178816 179012 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000612045"; exon_number "1"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 178816 179016 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000613355"; exon_number "1"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 178816 179008 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000613508"; exon_number "1"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 178816 179088 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000613988"; exon_number "1"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 178816 179052 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000616944"; exon_number "1"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu transcript 212824 215741 . - . gene_id "ENSG00000183784"; transcript_id "ENST00000382387"; NDR "NA"; txScore ""; txScore.noFit ""; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 212824 215741 . - . gene_id "ENSG00000183784"; transcript_id "ENST00000382387"; exon_number "1"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu transcript 214854 286636 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000469197"; NDR "NA"; txScore ""; txScore.noFit ""; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 214854 215029 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000469197"; exon_number "1"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu transcript 214865 465259 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000432829"; NDR "NA"; txScore ""; txScore.noFit ""; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu transcript 214865 340620 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000524396"; NDR "NA"; txScore ""; txScore.noFit ""; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 214865 215029 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000432829"; exon_number "1"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 214865 215029 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000524396"; exon_number "1"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu transcript 214868 340620 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000454469"; NDR "NA"; txScore ""; txScore.noFit ""; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 214868 215029 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000454469"; exon_number "1"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu transcript 215171 289579 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000479404"; NDR "NA"; txScore ""; txScore.noFit ""; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 215171 215416 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000479404"; exon_number "1"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 220748 220863 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000524396"; exon_number "2"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu transcript 267966 273002 . - . gene_id "ENSG00000235880"; transcript_id "ENST00000429661"; NDR "NA"; txScore ""; txScore.noFit ""; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 267966 268273 . - . gene_id "ENSG00000235880"; transcript_id "ENST00000429661"; exon_number "2"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 271627 271729 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000432829"; exon_number "2"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 271627 271729 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000454469"; exon_number "2"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 271627 271729 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000469197"; exon_number "2"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 271627 271729 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000479404"; exon_number "2"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 271627 271729 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000524396"; exon_number "3"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 272905 273002 . - . gene_id "ENSG00000235880"; transcript_id "ENST00000429661"; exon_number "1"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu transcript 273048 465259 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000453981"; NDR "NA"; txScore ""; txScore.noFit ""; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 273048 273100 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000453981"; exon_number "1"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu transcript 273050 340620 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000382341"; NDR "NA"; txScore ""; txScore.noFit ""; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu transcript 273050 304703 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000487230"; NDR "NA"; txScore ""; txScore.noFit ""; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 273050 273100 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000382341"; exon_number "1"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 273050 273100 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000487230"; exon_number "1"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu transcript 273059 381387 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000483757"; NDR "NA"; txScore ""; txScore.noFit ""; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 273059 273100 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000483757"; exon_number "1"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu transcript 273066 312941 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000478380"; NDR "NA"; txScore ""; txScore.noFit ""; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 273066 273100 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000478380"; exon_number "1"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu transcript 273070 464526 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000469391"; NDR "NA"; txScore ""; txScore.noFit ""; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 273070 273100 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000469391"; exon_number "1"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu transcript 273084 465241 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000495184"; NDR "NA"; txScore ""; txScore.noFit ""; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 273084 273100 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000495184"; exon_number "1"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 276994 277086 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000469197"; exon_number "3"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 280791 280905 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000487230"; exon_number "2"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 284375 284567 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000469197"; exon_number "4"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 286461 286636 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000382341"; exon_number "2"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 286461 286636 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000432829"; exon_number "3"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 286461 286636 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000453981"; exon_number "2"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 286461 286636 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000454469"; exon_number "3"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 286461 286636 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000469197"; exon_number "5"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 286461 286636 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000469391"; exon_number "2"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 286461 286636 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000478380"; exon_number "2"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 286461 286636 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000479404"; exon_number "3"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 286461 286636 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000483757"; exon_number "2"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 286461 286636 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000487230"; exon_number "3"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 286461 286636 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000495184"; exon_number "2"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 286461 286636 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000524396"; exon_number "4"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 289510 289581 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000382341"; exon_number "3"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 289510 289581 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000432829"; exon_number "4"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 289510 289581 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000453981"; exon_number "3"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 289510 289581 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000454469"; exon_number "4"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 289510 289581 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000469391"; exon_number "3"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 289510 289581 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000478380"; exon_number "3"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 289510 289579 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000479404"; exon_number "4"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 289510 289581 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000483757"; exon_number "3"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 289510 289581 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000487230"; exon_number "4"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 289510 289581 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000495184"; exon_number "3"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 289510 289581 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000524396"; exon_number "5"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 304581 304704 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000382341"; exon_number "4"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 304581 304704 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000432829"; exon_number "5"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 304581 304704 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000453981"; exon_number "4"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 304581 304704 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000454469"; exon_number "5"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 304581 304704 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000469391"; exon_number "4"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 304581 304704 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000478380"; exon_number "4"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 304581 304704 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000483757"; exon_number "4"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 304581 304703 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000487230"; exon_number "5"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 304581 304704 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000495184"; exon_number "4"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 304581 304704 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000524396"; exon_number "6"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 311954 312166 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000382341"; exon_number "5"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 311954 312166 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000432829"; exon_number "6"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 311954 312166 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000453981"; exon_number "5"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 311954 312166 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000454469"; exon_number "6"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 311954 312166 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000469391"; exon_number "5"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 311954 312941 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000478380"; exon_number "5"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 311954 312166 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000483757"; exon_number "5"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 311954 312166 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000495184"; exon_number "5"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 311954 312166 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000524396"; exon_number "7"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu transcript 311958 314466 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000474772"; NDR "NA"; txScore ""; txScore.noFit ""; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 311958 312166 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000474772"; exon_number "1"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 314292 314466 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000474772"; exon_number "2"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 317043 317128 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000382341"; exon_number "6"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 317043 317128 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000432829"; exon_number "7"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 317043 317128 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000453981"; exon_number "6"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 317043 317128 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000454469"; exon_number "7"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 317043 317128 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000469391"; exon_number "6"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 317043 317128 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000483757"; exon_number "6"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 317043 317128 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000495184"; exon_number "6"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 317043 317128 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000524396"; exon_number "8"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 325671 325737 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000382341"; exon_number "7"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 325671 325737 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000432829"; exon_number "8"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 325671 325737 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000453981"; exon_number "7"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 325671 325737 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000454469"; exon_number "8"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 325671 325737 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000469391"; exon_number "7"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 325671 325737 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000483757"; exon_number "7"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 325671 325737 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000495184"; exon_number "7"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 325671 325737 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000524396"; exon_number "9"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 328022 328171 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000382341"; exon_number "8"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 328022 328171 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000432829"; exon_number "9"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 328022 328171 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000453981"; exon_number "8"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 328022 328171 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000454469"; exon_number "9"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 328022 328171 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000469391"; exon_number "8"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 328022 328171 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000483757"; exon_number "8"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 328022 328171 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000495184"; exon_number "8"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 328022 328171 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000524396"; exon_number "10"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 332398 332478 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000382341"; exon_number "9"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 332398 332478 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000432829"; exon_number "10"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 332398 332478 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000453981"; exon_number "9"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 332398 332478 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000454469"; exon_number "10"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 332398 332478 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000469391"; exon_number "9"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 332398 332478 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000483757"; exon_number "9"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 332398 332478 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000495184"; exon_number "9"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 332398 332478 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000524396"; exon_number "11"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 334225 334384 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000382341"; exon_number "10"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 334225 334384 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000432829"; exon_number "11"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 334225 334384 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000453981"; exon_number "10"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 334225 334384 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000454469"; exon_number "11"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 334225 334384 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000469391"; exon_number "10"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 334225 334384 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000483757"; exon_number "10"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 334225 334384 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000495184"; exon_number "10"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 334225 334384 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000524396"; exon_number "12"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 336582 336718 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000382341"; exon_number "11"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 336582 336718 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000432829"; exon_number "12"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 336582 336718 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000453981"; exon_number "11"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 336582 336718 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000454469"; exon_number "12"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 336582 336718 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000469391"; exon_number "11"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 336582 336718 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000483757"; exon_number "11"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 336582 336718 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000495184"; exon_number "11"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 336582 336718 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000524396"; exon_number "13"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 339006 339099 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000382341"; exon_number "12"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 339006 339099 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000432829"; exon_number "13"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 339006 339099 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000453981"; exon_number "12"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 339006 339099 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000454469"; exon_number "13"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 339006 339099 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000469391"; exon_number "12"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 339006 339099 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000483757"; exon_number "12"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 339006 339099 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000495184"; exon_number "12"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 339006 339099 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000524396"; exon_number "14"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 340159 340620 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000382341"; exon_number "13"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 340159 340321 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000432829"; exon_number "14"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 340159 340321 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000453981"; exon_number "13"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 340159 340620 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000454469"; exon_number "14"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 340159 340321 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000469391"; exon_number "13"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 340159 340321 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000483757"; exon_number "13"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 340159 340321 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000495184"; exon_number "13"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 340159 340620 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000524396"; exon_number "15"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 365591 366552 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000483757"; exon_number "14"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu transcript 366229 405099 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000382331"; NDR "NA"; txScore ""; txScore.noFit ""; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 366229 366552 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000382331"; exon_number "1"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu transcript 366251 465255 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000382329"; NDR "NA"; txScore ""; txScore.noFit ""; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 366251 366552 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000382329"; exon_number "1"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 368018 368300 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000382329"; exon_number "2"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 368018 368135 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000382331"; exon_number "2"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 368018 368135 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000432829"; exon_number "15"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 368018 368135 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000453981"; exon_number "14"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 368018 368135 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000469391"; exon_number "14"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 368018 368135 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000483757"; exon_number "15"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 368018 370300 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000495184"; exon_number "14"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 369222 369447 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000483757"; exon_number "16"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 370230 370300 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000382329"; exon_number "3"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 370230 370300 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000382331"; exon_number "3"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 370230 370300 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000432829"; exon_number "16"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 370230 370300 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000453981"; exon_number "15"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 370230 370300 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000469391"; exon_number "15"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 370230 370300 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000483757"; exon_number "17"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 371428 371566 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000382329"; exon_number "4"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 371428 371566 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000432829"; exon_number "17"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 371428 371566 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000453981"; exon_number "16"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 371428 371566 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000469391"; exon_number "16"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 371428 371566 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000483757"; exon_number "18"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 371428 371566 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000495184"; exon_number "15"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 372185 372286 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000382329"; exon_number "5"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 372185 372286 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000382331"; exon_number "4"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 372185 372286 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000432829"; exon_number "18"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 372185 372286 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000453981"; exon_number "17"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 372185 372286 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000469391"; exon_number "17"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 372185 372286 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000483757"; exon_number "19"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 372185 372286 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000495184"; exon_number "16"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 376210 376305 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000382329"; exon_number "6"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 376210 376305 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000382331"; exon_number "5"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 376210 376305 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000432829"; exon_number "19"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 376210 376305 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000453981"; exon_number "18"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 376210 376305 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000469391"; exon_number "18"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 376210 376305 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000483757"; exon_number "20"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 376210 376305 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000495184"; exon_number "17"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 376977 377211 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000382329"; exon_number "7"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 376977 377211 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000382331"; exon_number "6"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 376977 377211 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000432829"; exon_number "20"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 376977 377211 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000453981"; exon_number "19"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 376977 377211 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000469391"; exon_number "19"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 376977 377211 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000483757"; exon_number "21"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 376977 377211 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000495184"; exon_number "18"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 379771 379935 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000382329"; exon_number "8"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 379771 379935 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000382331"; exon_number "7"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 379771 379935 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000432829"; exon_number "21"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 379771 379935 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000453981"; exon_number "20"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 379771 379935 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000469391"; exon_number "20"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 379771 379935 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000483757"; exon_number "22"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 379771 379935 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000495184"; exon_number "19"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 380279 381387 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000483757"; exon_number "23"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 382513 382685 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000382329"; exon_number "9"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 382513 382685 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000382331"; exon_number "8"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 382513 382685 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000432829"; exon_number "22"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 382513 382685 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000453981"; exon_number "21"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 382513 382685 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000469391"; exon_number "21"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 382513 382685 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000495184"; exon_number "20"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 386331 386426 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000382329"; exon_number "10"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 386331 386426 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000382331"; exon_number "9"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 386331 386426 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000432829"; exon_number "23"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 386331 386426 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000453981"; exon_number "22"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 386331 386426 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000495184"; exon_number "21"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 390471 390566 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000382329"; exon_number "11"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 390471 390566 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000382331"; exon_number "10"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 390471 390566 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000432829"; exon_number "24"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 390471 390566 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000453981"; exon_number "23"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 390471 390566 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000469391"; exon_number "22"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 390471 390566 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000495184"; exon_number "22"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 396785 396934 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000382329"; exon_number "12"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 396785 396934 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000382331"; exon_number "11"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 396785 396934 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000432829"; exon_number "25"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 396785 396934 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000453981"; exon_number "24"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 396785 396934 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000469391"; exon_number "23"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 396785 396934 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000495184"; exon_number "23"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 399146 399259 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000382329"; exon_number "13"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 399146 399259 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000382331"; exon_number "12"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 399146 399259 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000432829"; exon_number "26"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 399146 399259 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000453981"; exon_number "25"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 399146 399259 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000469391"; exon_number "24"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 399146 399259 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000495184"; exon_number "24"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 404918 405073 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000382329"; exon_number "14"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 404918 405099 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000382331"; exon_number "13"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 404918 405073 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000432829"; exon_number "27"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 404918 405073 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000453981"; exon_number "26"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 404918 405073 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000469391"; exon_number "25"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 404918 405073 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000495184"; exon_number "25"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 406930 407069 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000382329"; exon_number "15"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 406930 407069 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000432829"; exon_number "28"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 406930 407069 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000453981"; exon_number "27"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 406930 407069 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000469391"; exon_number "26"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 406930 407069 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000495184"; exon_number "26"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 414782 414951 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000382329"; exon_number "16"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 414782 414951 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000432829"; exon_number "29"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 414782 414951 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000453981"; exon_number "28"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 414782 414951 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000469391"; exon_number "27"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 414782 414951 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000495184"; exon_number "27"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 418068 418207 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000382329"; exon_number "17"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 418068 418207 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000432829"; exon_number "30"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 418068 418207 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000453981"; exon_number "29"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 418068 418207 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000469391"; exon_number "28"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 418068 418207 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000495184"; exon_number "28"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu transcript 420116 426953 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000493666"; NDR "NA"; txScore ""; txScore.noFit ""; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 420116 420180 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000493666"; exon_number "1"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 420401 420583 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000382329"; exon_number "18"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 420401 420583 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000432829"; exon_number "31"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 420401 420583 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000453981"; exon_number "30"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 420401 420583 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000469391"; exon_number "29"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 420401 420583 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000493666"; exon_number "2"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 420401 420583 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000495184"; exon_number "29"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 420949 421078 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000382329"; exon_number "19"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 420949 421078 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000432829"; exon_number "32"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 420949 421078 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000453981"; exon_number "31"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 420949 421078 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000469391"; exon_number "30"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 420949 421078 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000493666"; exon_number "3"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 420949 421078 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000495184"; exon_number "30"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 422048 422135 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000382329"; exon_number "20"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 422048 422135 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000432829"; exon_number "33"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 422048 422135 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000453981"; exon_number "32"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 422048 422135 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000469391"; exon_number "31"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 422048 422135 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000493666"; exon_number "4"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 422048 422135 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000495184"; exon_number "31"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 426885 426981 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000382329"; exon_number "21"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 426885 426981 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000432829"; exon_number "34"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 426885 426981 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000453981"; exon_number "33"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 426885 426981 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000469391"; exon_number "32"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 426885 426953 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000493666"; exon_number "5"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 426885 426981 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000495184"; exon_number "32"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 428362 428496 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000382329"; exon_number "22"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 428362 428496 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000432829"; exon_number "35"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 428362 428496 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000453981"; exon_number "34"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 428362 428496 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000469391"; exon_number "33"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 428362 428496 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000495184"; exon_number "33"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 429702 429854 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000382329"; exon_number "23"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 429702 429854 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000432829"; exon_number "36"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 429702 429854 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000453981"; exon_number "35"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 429702 429854 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000469391"; exon_number "34"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 429702 429854 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000495184"; exon_number "34"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 432166 432324 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000382329"; exon_number "24"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 432166 432324 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000432829"; exon_number "37"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 432166 432324 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000453981"; exon_number "36"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 432166 432324 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000469391"; exon_number "35"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 432166 432324 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000495184"; exon_number "35"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 433875 433975 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000382329"; exon_number "25"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 433875 433975 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000432829"; exon_number "38"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 433875 433975 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000453981"; exon_number "37"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 433875 433975 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000469391"; exon_number "36"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 433875 433975 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000495184"; exon_number "36"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 434783 434975 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000382329"; exon_number "26"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 434783 434975 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000432829"; exon_number "39"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 434783 434975 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000453981"; exon_number "38"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 434783 434975 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000469391"; exon_number "37"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 434783 434975 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000495184"; exon_number "37"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 439245 439388 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000382329"; exon_number "27"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 439245 439388 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000432829"; exon_number "40"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 439245 439388 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000453981"; exon_number "39"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 439245 439388 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000469391"; exon_number "38"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 439245 439388 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000495184"; exon_number "38"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 441286 441417 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000382329"; exon_number "28"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 441286 441417 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000432829"; exon_number "41"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 441286 441417 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000453981"; exon_number "40"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 441286 441417 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000469391"; exon_number "39"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 441286 441417 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000495184"; exon_number "39"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 441875 442009 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000382329"; exon_number "29"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 441875 442009 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000432829"; exon_number "42"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 441875 442009 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000453981"; exon_number "41"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 441875 442009 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000469391"; exon_number "40"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 441875 442009 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000495184"; exon_number "40"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 443427 443516 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000382329"; exon_number "30"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 443427 443516 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000432829"; exon_number "43"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 443427 443516 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000453981"; exon_number "42"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 443427 443516 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000469391"; exon_number "41"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 443427 443516 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000495184"; exon_number "41"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 446370 446606 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000382329"; exon_number "31"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 446370 446606 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000432829"; exon_number "44"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 446370 446606 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000453981"; exon_number "43"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 446370 446606 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000469391"; exon_number "42"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 446370 446606 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000495184"; exon_number "42"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 449784 449927 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000382329"; exon_number "32"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 449784 449927 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000432829"; exon_number "45"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 449784 449927 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000453981"; exon_number "44"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 449784 449927 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000469391"; exon_number "43"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 449784 449927 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000495184"; exon_number "43"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 452011 452117 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000382329"; exon_number "33"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 452011 452117 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000432829"; exon_number "46"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 452011 452117 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000453981"; exon_number "45"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 452011 452117 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000469391"; exon_number "44"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 452011 452117 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000495184"; exon_number "44"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu transcript 452492 469836 . - . gene_id "ENSG00000227155"; transcript_id "ENST00000591577"; NDR "NA"; txScore ""; txScore.noFit ""; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 452492 452948 . - . gene_id "ENSG00000227155"; transcript_id "ENST00000591577"; exon_number "5"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu transcript 452493 456207 . - . gene_id "ENSG00000227155"; transcript_id "ENST00000628764"; NDR "NA"; txScore ""; txScore.noFit ""; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 452493 452948 . - . gene_id "ENSG00000227155"; transcript_id "ENST00000628764"; exon_number "3"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu transcript 454304 492248 . - . gene_id "ENSG00000227155"; transcript_id "ENST00000415004"; NDR "NA"; txScore ""; txScore.noFit ""; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 454304 454606 . - . gene_id "ENSG00000227155"; transcript_id "ENST00000415004"; exon_number "4"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu transcript 454432 456988 . - . gene_id "ENSG00000227155"; transcript_id "ENST00000585944"; NDR "NA"; txScore ""; txScore.noFit ""; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 454432 454606 . - . gene_id "ENSG00000227155"; transcript_id "ENST00000585944"; exon_number "2"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 454439 454606 . - . gene_id "ENSG00000227155"; transcript_id "ENST00000591577"; exon_number "4"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu transcript 454447 469802 . - . gene_id "ENSG00000227155"; transcript_id "ENST00000589287"; NDR "NA"; txScore ""; txScore.noFit ""; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 454447 454606 . - . gene_id "ENSG00000227155"; transcript_id "ENST00000589287"; exon_number "4"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 454507 454606 . - . gene_id "ENSG00000227155"; transcript_id "ENST00000628764"; exon_number "2"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu transcript 454576 469802 . - . gene_id "ENSG00000227155"; transcript_id "ENST00000589387"; NDR "NA"; txScore ""; txScore.noFit ""; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 454576 454606 . - . gene_id "ENSG00000227155"; transcript_id "ENST00000589387"; exon_number "4"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu transcript 454585 470961 . - . gene_id "ENSG00000227155"; transcript_id "ENST00000586805"; NDR "NA"; txScore ""; txScore.noFit ""; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 454585 454606 . - . gene_id "ENSG00000227155"; transcript_id "ENST00000586805"; exon_number "3"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu transcript 456201 460507 . - . gene_id "ENSG00000227155"; transcript_id "ENST00000585631"; NDR "NA"; txScore ""; txScore.noFit ""; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 456201 456703 . - . gene_id "ENSG00000227155"; transcript_id "ENST00000415004"; exon_number "3"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 456201 456703 . - . gene_id "ENSG00000227155"; transcript_id "ENST00000585631"; exon_number "2"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 456201 456988 . - . gene_id "ENSG00000227155"; transcript_id "ENST00000585944"; exon_number "1"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 456201 456703 . - . gene_id "ENSG00000227155"; transcript_id "ENST00000586805"; exon_number "2"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 456201 456703 . - . gene_id "ENSG00000227155"; transcript_id "ENST00000589287"; exon_number "3"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 456201 456703 . - . gene_id "ENSG00000227155"; transcript_id "ENST00000589387"; exon_number "3"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 456201 456703 . - . gene_id "ENSG00000227155"; transcript_id "ENST00000591577"; exon_number "3"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 456201 456207 . - . gene_id "ENSG00000227155"; transcript_id "ENST00000628764"; exon_number "1"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu transcript 456204 470816 . - . gene_id "ENSG00000227155"; transcript_id "ENST00000593137"; NDR "NA"; txScore ""; txScore.noFit ""; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 456204 456703 . - . gene_id "ENSG00000227155"; transcript_id "ENST00000593137"; exon_number "4"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu transcript 456211 460227 . - . gene_id "ENSG00000227155"; transcript_id "ENST00000590240"; NDR "NA"; txScore ""; txScore.noFit ""; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 456211 456703 . - . gene_id "ENSG00000227155"; transcript_id "ENST00000590240"; exon_number "4"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu transcript 456518 467390 . - . gene_id "ENSG00000227155"; transcript_id "ENST00000592805"; NDR "NA"; txScore ""; txScore.noFit ""; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 456518 456703 . - . gene_id "ENSG00000227155"; transcript_id "ENST00000592805"; exon_number "2"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu transcript 456521 470934 . - . gene_id "ENSG00000227155"; transcript_id "ENST00000585819"; NDR "NA"; txScore ""; txScore.noFit ""; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 456521 456703 . - . gene_id "ENSG00000227155"; transcript_id "ENST00000585819"; exon_number "5"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu transcript 456530 466866 . - . gene_id "ENSG00000227155"; transcript_id "ENST00000588474"; NDR "NA"; txScore ""; txScore.noFit ""; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 456530 456703 . - . gene_id "ENSG00000227155"; transcript_id "ENST00000588474"; exon_number "5"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu transcript 456545 467336 . - . gene_id "ENSG00000227155"; transcript_id "ENST00000590518"; NDR "NA"; txScore ""; txScore.noFit ""; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 456545 456703 . - . gene_id "ENSG00000227155"; transcript_id "ENST00000590518"; exon_number "4"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 456915 457047 . - . gene_id "ENSG00000227155"; transcript_id "ENST00000585819"; exon_number "4"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 456915 457047 . - . gene_id "ENSG00000227155"; transcript_id "ENST00000588474"; exon_number "4"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 456915 457047 . - . gene_id "ENSG00000227155"; transcript_id "ENST00000590518"; exon_number "3"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 456915 457047 . - . gene_id "ENSG00000227155"; transcript_id "ENST00000593137"; exon_number "3"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu transcript 457004 467219 . - . gene_id "ENSG00000227155"; transcript_id "ENST00000588989"; NDR "NA"; txScore ""; txScore.noFit ""; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 457004 457047 . - . gene_id "ENSG00000227155"; transcript_id "ENST00000588989"; exon_number "4"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 458117 458281 . - . gene_id "ENSG00000227155"; transcript_id "ENST00000590240"; exon_number "3"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 458370 458423 . - . gene_id "ENSG00000227155"; transcript_id "ENST00000590240"; exon_number "2"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu transcript 459716 466065 . - . gene_id "ENSG00000227155"; transcript_id "ENST00000608617"; NDR "NA"; txScore ""; txScore.noFit ""; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 459716 460507 . - . gene_id "ENSG00000227155"; transcript_id "ENST00000585631"; exon_number "1"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 459716 459866 . - . gene_id "ENSG00000227155"; transcript_id "ENST00000585819"; exon_number "3"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 459716 459866 . - . gene_id "ENSG00000227155"; transcript_id "ENST00000588474"; exon_number "3"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 459716 459866 . - . gene_id "ENSG00000227155"; transcript_id "ENST00000588989"; exon_number "3"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 459716 460227 . - . gene_id "ENSG00000227155"; transcript_id "ENST00000590240"; exon_number "1"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 459716 459815 . - . gene_id "ENSG00000227155"; transcript_id "ENST00000608617"; exon_number "2"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 463517 463687 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000382329"; exon_number "34"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 463517 463687 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000432829"; exon_number "47"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 463517 463687 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000453981"; exon_number "46"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 463517 463687 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000469391"; exon_number "45"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 463517 463687 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000495184"; exon_number "45"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu transcript 463555 465247 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000462618"; NDR "NA"; txScore ""; txScore.noFit ""; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 463555 463687 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000462618"; exon_number "1"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 464159 465255 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000382329"; exon_number "35"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 464159 465259 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000432829"; exon_number "48"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 464159 465259 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000453981"; exon_number "47"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 464159 464278 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000462618"; exon_number "2"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 464159 464526 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000469391"; exon_number "46"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 464159 465241 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000495184"; exon_number "46"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 465073 465247 . + . gene_id "ENSG00000107099"; transcript_id "ENST00000462618"; exon_number "3"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 465962 466069 . - . gene_id "ENSG00000227155"; transcript_id "ENST00000585819"; exon_number "2"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 465962 466069 . - . gene_id "ENSG00000227155"; transcript_id "ENST00000588474"; exon_number "2"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 465962 466069 . - . gene_id "ENSG00000227155"; transcript_id "ENST00000588989"; exon_number "2"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 465962 466069 . - . gene_id "ENSG00000227155"; transcript_id "ENST00000589387"; exon_number "2"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 465962 466069 . - . gene_id "ENSG00000227155"; transcript_id "ENST00000590518"; exon_number "2"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 465962 466069 . - . gene_id "ENSG00000227155"; transcript_id "ENST00000591577"; exon_number "2"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 465962 466069 . - . gene_id "ENSG00000227155"; transcript_id "ENST00000593137"; exon_number "2"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 465962 466065 . - . gene_id "ENSG00000227155"; transcript_id "ENST00000608617"; exon_number "1"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 466688 466866 . - . gene_id "ENSG00000227155"; transcript_id "ENST00000588474"; exon_number "1"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 466688 467219 . - . gene_id "ENSG00000227155"; transcript_id "ENST00000588989"; exon_number "1"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 466688 466853 . - . gene_id "ENSG00000227155"; transcript_id "ENST00000589287"; exon_number "2"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 466688 467390 . - . gene_id "ENSG00000227155"; transcript_id "ENST00000592805"; exon_number "1"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 466900 467336 . - . gene_id "ENSG00000227155"; transcript_id "ENST00000590518"; exon_number "1"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 469722 469802 . - . gene_id "ENSG00000227155"; transcript_id "ENST00000589287"; exon_number "1"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 469722 469802 . - . gene_id "ENSG00000227155"; transcript_id "ENST00000589387"; exon_number "1"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 469722 469836 . - . gene_id "ENSG00000227155"; transcript_id "ENST00000591577"; exon_number "1"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu transcript 470291 746105 . + . gene_id "ENSG00000107104"; transcript_id "ENST00000382303"; NDR "NA"; txScore ""; txScore.noFit ""; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 470291 470374 . + . gene_id "ENSG00000107104"; transcript_id "ENST00000382303"; exon_number "1"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 470556 470682 . + . gene_id "ENSG00000107104"; transcript_id "ENST00000382303"; exon_number "2"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu transcript 470592 484491 . + . gene_id "ENSG00000107104"; transcript_id "ENST00000467541"; NDR "NA"; txScore ""; txScore.noFit ""; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 470592 470677 . + . gene_id "ENSG00000107104"; transcript_id "ENST00000467541"; exon_number "1"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 470765 470934 . - . gene_id "ENSG00000227155"; transcript_id "ENST00000585819"; exon_number "1"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 470765 470961 . - . gene_id "ENSG00000227155"; transcript_id "ENST00000586805"; exon_number "1"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 470765 470816 . - . gene_id "ENSG00000227155"; transcript_id "ENST00000593137"; exon_number "1"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 471449 471586 . + . gene_id "ENSG00000107104"; transcript_id "ENST00000467541"; exon_number "2"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu transcript 471467 476769 . + . gene_id "ENSG00000107104"; transcript_id "ENST00000475690"; NDR "NA"; txScore ""; txScore.noFit ""; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 471467 471586 . + . gene_id "ENSG00000107104"; transcript_id "ENST00000475690"; exon_number "1"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 473194 473273 . + . gene_id "ENSG00000107104"; transcript_id "ENST00000382303"; exon_number "3"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 473194 473273 . + . gene_id "ENSG00000107104"; transcript_id "ENST00000467541"; exon_number "3"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 473194 473273 . + . gene_id "ENSG00000107104"; transcript_id "ENST00000475690"; exon_number "2"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 476628 476769 . + . gene_id "ENSG00000107104"; transcript_id "ENST00000475690"; exon_number "3"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu transcript 477750 478423 . + . gene_id "ENSG00000235330"; transcript_id "ENST00000598100"; NDR "NA"; txScore ""; txScore.noFit ""; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 477750 478423 . + . gene_id "ENSG00000235330"; transcript_id "ENST00000598100"; exon_number "1"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu transcript 477856 478349 . + . gene_id "ENSG00000235330"; transcript_id "ENST00000455592"; NDR "NA"; txScore ""; txScore.noFit ""; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 477856 478349 . + . gene_id "ENSG00000235330"; transcript_id "ENST00000455592"; exon_number "1"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 484282 484491 . + . gene_id "ENSG00000107104"; transcript_id "ENST00000467541"; exon_number "4"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu transcript 487774 495610 . + . gene_id "ENSG00000228115"; transcript_id "ENST00000442442"; NDR "NA"; txScore ""; txScore.noFit ""; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 487774 487803 . + . gene_id "ENSG00000228115"; transcript_id "ENST00000442442"; exon_number "1"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 488957 489066 . - . gene_id "ENSG00000227155"; transcript_id "ENST00000415004"; exon_number "2"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 492084 492248 . - . gene_id "ENSG00000227155"; transcript_id "ENST00000415004"; exon_number "1"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 495238 495610 . + . gene_id "ENSG00000228115"; transcript_id "ENST00000442442"; exon_number "2"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu transcript 504695 746106 . + . gene_id "ENSG00000107104"; transcript_id "ENST00000619269"; NDR "NA"; txScore ""; txScore.noFit ""; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 504695 504754 . + . gene_id "ENSG00000107104"; transcript_id "ENST00000619269"; exon_number "1"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu transcript 504702 746103 . + . gene_id "ENSG00000107104"; transcript_id "ENST00000489369"; NDR "NA"; txScore ""; txScore.noFit ""; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 504702 504754 . + . gene_id "ENSG00000107104"; transcript_id "ENST00000489369"; exon_number "1"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu transcript 504703 734129 . + . gene_id "ENSG00000107104"; transcript_id "ENST00000354485"; NDR "NA"; txScore ""; txScore.noFit ""; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 504703 504754 . + . gene_id "ENSG00000107104"; transcript_id "ENST00000354485"; exon_number "1"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu transcript 504716 746105 . + . gene_id "ENSG00000107104"; transcript_id "ENST00000382297"; NDR "NA"; txScore ""; txScore.noFit ""; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 504716 504754 . + . gene_id "ENSG00000107104"; transcript_id "ENST00000382297"; exon_number "1"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 539516 539633 . + . gene_id "ENSG00000107104"; transcript_id "ENST00000382303"; exon_number "4"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 540508 540667 . + . gene_id "ENSG00000107104"; transcript_id "ENST00000382303"; exon_number "5"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu transcript 547317 549531 . + . gene_id "ENSG00000226403"; transcript_id "ENST00000441028"; NDR "NA"; txScore ""; txScore.noFit ""; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 547317 547341 . + . gene_id "ENSG00000226403"; transcript_id "ENST00000441028"; exon_number "1"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu transcript 547318 549531 . + . gene_id "ENSG00000226403"; transcript_id "ENST00000444793"; NDR "NA"; txScore ""; txScore.noFit ""; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 547318 547341 . + . gene_id "ENSG00000226403"; transcript_id "ENST00000444793"; exon_number "1"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 549107 549531 . + . gene_id "ENSG00000226403"; transcript_id "ENST00000444793"; exon_number "2"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 549107 549721 . + . gene_id "ENSG00000107104"; transcript_id "ENST00000619269"; exon_number "2"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 549190 549531 . + . gene_id "ENSG00000226403"; transcript_id "ENST00000441028"; exon_number "2"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu transcript 558826 558930 . + . gene_id "ENSG00000202172"; transcript_id "ENST00000365302"; NDR "NA"; txScore ""; txScore.noFit ""; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 558826 558930 . + . gene_id "ENSG00000202172"; transcript_id "ENST00000365302"; exon_number "1"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu transcript 659986 660326 . + . gene_id "ENSG00000229875"; transcript_id "ENST00000421436"; NDR "NA"; txScore ""; txScore.noFit ""; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 659986 660326 . + . gene_id "ENSG00000229875"; transcript_id "ENST00000421436"; exon_number "1"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu transcript 673478 685555 . - . gene_id "ENSG00000227914"; transcript_id "ENST00000421645"; NDR "NA"; txScore ""; txScore.noFit ""; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 673478 674379 . - . gene_id "ENSG00000227914"; transcript_id "ENST00000421645"; exon_number "3"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu transcript 674124 677628 . - . gene_id "ENSG00000227914"; transcript_id "ENST00000608097"; NDR "NA"; txScore ""; txScore.noFit ""; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 674124 674379 . - . gene_id "ENSG00000227914"; transcript_id "ENST00000608097"; exon_number "2"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 676890 677009 . + . gene_id "ENSG00000107104"; transcript_id "ENST00000354485"; exon_number "2"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 676890 677009 . + . gene_id "ENSG00000107104"; transcript_id "ENST00000382297"; exon_number "2"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 676890 677009 . + . gene_id "ENSG00000107104"; transcript_id "ENST00000382303"; exon_number "6"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 676890 677009 . + . gene_id "ENSG00000107104"; transcript_id "ENST00000489369"; exon_number "2"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 676890 677009 . + . gene_id "ENSG00000107104"; transcript_id "ENST00000619269"; exon_number "3"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 677542 677628 . - . gene_id "ENSG00000227914"; transcript_id "ENST00000608097"; exon_number "1"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 680857 681046 . - . gene_id "ENSG00000227914"; transcript_id "ENST00000421645"; exon_number "2"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 685528 685555 . - . gene_id "ENSG00000227914"; transcript_id "ENST00000421645"; exon_number "1"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu transcript 706889 746103 . + . gene_id "ENSG00000107104"; transcript_id "ENST00000382293"; NDR "NA"; txScore ""; txScore.noFit ""; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 706889 707247 . + . gene_id "ENSG00000107104"; transcript_id "ENST00000382293"; exon_number "1"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 710804 713464 . + . gene_id "ENSG00000107104"; transcript_id "ENST00000354485"; exon_number "3"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 710804 713464 . + . gene_id "ENSG00000107104"; transcript_id "ENST00000382293"; exon_number "2"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 710804 713464 . + . gene_id "ENSG00000107104"; transcript_id "ENST00000382297"; exon_number "3"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 710804 713464 . + . gene_id "ENSG00000107104"; transcript_id "ENST00000382303"; exon_number "7"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 710804 713464 . + . gene_id "ENSG00000107104"; transcript_id "ENST00000489369"; exon_number "3"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 710804 713464 . + . gene_id "ENSG00000107104"; transcript_id "ENST00000619269"; exon_number "4"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 730051 734129 . + . gene_id "ENSG00000107104"; transcript_id "ENST00000354485"; exon_number "4"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 730051 730248 . + . gene_id "ENSG00000107104"; transcript_id "ENST00000382293"; exon_number "3"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 730051 730248 . + . gene_id "ENSG00000107104"; transcript_id "ENST00000382297"; exon_number "4"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 730051 730248 . + . gene_id "ENSG00000107104"; transcript_id "ENST00000382303"; exon_number "8"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 730051 730248 . + . gene_id "ENSG00000107104"; transcript_id "ENST00000489369"; exon_number "4"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 730051 730248 . + . gene_id "ENSG00000107104"; transcript_id "ENST00000619269"; exon_number "5"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 731158 731266 . + . gene_id "ENSG00000107104"; transcript_id "ENST00000382293"; exon_number "4"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 731158 731266 . + . gene_id "ENSG00000107104"; transcript_id "ENST00000382297"; exon_number "5"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 731158 731266 . + . gene_id "ENSG00000107104"; transcript_id "ENST00000382303"; exon_number "9"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 731158 731266 . + . gene_id "ENSG00000107104"; transcript_id "ENST00000489369"; exon_number "5"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 731158 731266 . + . gene_id "ENSG00000107104"; transcript_id "ENST00000619269"; exon_number "6"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 732378 732617 . + . gene_id "ENSG00000107104"; transcript_id "ENST00000382293"; exon_number "5"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 732378 732617 . + . gene_id "ENSG00000107104"; transcript_id "ENST00000382297"; exon_number "6"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 732378 732617 . + . gene_id "ENSG00000107104"; transcript_id "ENST00000382303"; exon_number "10"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 732378 734835 . + . gene_id "ENSG00000107104"; transcript_id "ENST00000489369"; exon_number "6"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 732378 732617 . + . gene_id "ENSG00000107104"; transcript_id "ENST00000619269"; exon_number "7"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu transcript 732442 746102 . + . gene_id "ENSG00000107104"; transcript_id "ENST00000382289"; NDR "NA"; txScore ""; txScore.noFit ""; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 732442 732617 . + . gene_id "ENSG00000107104"; transcript_id "ENST00000382289"; exon_number "1"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu transcript 734748 746104 . + . gene_id "ENSG00000107104"; transcript_id "ENST00000382286"; NDR "NA"; txScore ""; txScore.noFit ""; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 734748 734835 . + . gene_id "ENSG00000107104"; transcript_id "ENST00000382286"; exon_number "1"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 734748 734835 . + . gene_id "ENSG00000107104"; transcript_id "ENST00000382289"; exon_number "2"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 734748 734835 . + . gene_id "ENSG00000107104"; transcript_id "ENST00000382293"; exon_number "6"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 734748 734835 . + . gene_id "ENSG00000107104"; transcript_id "ENST00000382297"; exon_number "7"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 734748 734835 . + . gene_id "ENSG00000107104"; transcript_id "ENST00000382303"; exon_number "11"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 734748 734835 . + . gene_id "ENSG00000107104"; transcript_id "ENST00000619269"; exon_number "8"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 735712 735780 . + . gene_id "ENSG00000107104"; transcript_id "ENST00000382289"; exon_number "3"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 738285 738504 . + . gene_id "ENSG00000107104"; transcript_id "ENST00000382286"; exon_number "2"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 738285 738504 . + . gene_id "ENSG00000107104"; transcript_id "ENST00000382289"; exon_number "4"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 738285 738504 . + . gene_id "ENSG00000107104"; transcript_id "ENST00000382293"; exon_number "7"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 738285 738504 . + . gene_id "ENSG00000107104"; transcript_id "ENST00000382297"; exon_number "8"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 738285 738504 . + . gene_id "ENSG00000107104"; transcript_id "ENST00000382303"; exon_number "12"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 738285 738504 . + . gene_id "ENSG00000107104"; transcript_id "ENST00000489369"; exon_number "7"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 738285 738504 . + . gene_id "ENSG00000107104"; transcript_id "ENST00000619269"; exon_number "9"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 740792 740934 . + . gene_id "ENSG00000107104"; transcript_id "ENST00000382286"; exon_number "3"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 740792 740934 . + . gene_id "ENSG00000107104"; transcript_id "ENST00000382289"; exon_number "5"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 740792 740934 . + . gene_id "ENSG00000107104"; transcript_id "ENST00000382293"; exon_number "8"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 740792 740934 . + . gene_id "ENSG00000107104"; transcript_id "ENST00000382297"; exon_number "9"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 740792 740934 . + . gene_id "ENSG00000107104"; transcript_id "ENST00000382303"; exon_number "13"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 740792 740934 . + . gene_id "ENSG00000107104"; transcript_id "ENST00000489369"; exon_number "8"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 740792 740934 . + . gene_id "ENSG00000107104"; transcript_id "ENST00000619269"; exon_number "10"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 742205 742405 . + . gene_id "ENSG00000107104"; transcript_id "ENST00000382286"; exon_number "4"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 742205 742405 . + . gene_id "ENSG00000107104"; transcript_id "ENST00000382289"; exon_number "6"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 742205 742405 . + . gene_id "ENSG00000107104"; transcript_id "ENST00000382293"; exon_number "9"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 742205 742405 . + . gene_id "ENSG00000107104"; transcript_id "ENST00000382297"; exon_number "10"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 742205 742405 . + . gene_id "ENSG00000107104"; transcript_id "ENST00000382303"; exon_number "14"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 742205 742405 . + . gene_id "ENSG00000107104"; transcript_id "ENST00000489369"; exon_number "9"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 742205 742405 . + . gene_id "ENSG00000107104"; transcript_id "ENST00000619269"; exon_number "11"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 744491 746104 . + . gene_id "ENSG00000107104"; transcript_id "ENST00000382286"; exon_number "5"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 744491 744589 . + . gene_id "ENSG00000107104"; transcript_id "ENST00000382289"; exon_number "7"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 744491 744589 . + . gene_id "ENSG00000107104"; transcript_id "ENST00000382293"; exon_number "10"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 744491 744589 . + . gene_id "ENSG00000107104"; transcript_id "ENST00000382297"; exon_number "11"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 744491 744589 . + . gene_id "ENSG00000107104"; transcript_id "ENST00000382303"; exon_number "15"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 744491 744589 . + . gene_id "ENSG00000107104"; transcript_id "ENST00000489369"; exon_number "10"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 744491 744589 . + . gene_id "ENSG00000107104"; transcript_id "ENST00000619269"; exon_number "12"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 745173 746102 . + . gene_id "ENSG00000107104"; transcript_id "ENST00000382289"; exon_number "8"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 745173 746103 . + . gene_id "ENSG00000107104"; transcript_id "ENST00000382293"; exon_number "11"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 745173 746105 . + . gene_id "ENSG00000107104"; transcript_id "ENST00000382297"; exon_number "12"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 745173 746105 . + . gene_id "ENSG00000107104"; transcript_id "ENST00000382303"; exon_number "16"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 745173 746103 . + . gene_id "ENSG00000107104"; transcript_id "ENST00000489369"; exon_number "11"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 745173 746106 . + . gene_id "ENSG00000107104"; transcript_id "ENST00000619269"; exon_number "13"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu transcript 841690 969090 . + . gene_id "ENSG00000137090"; transcript_id "ENST00000382276"; NDR "NA"; txScore ""; txScore.noFit ""; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu transcript 841690 894985 . + . gene_id "ENSG00000137090"; transcript_id "ENST00000564322"; NDR "NA"; txScore ""; txScore.noFit ""; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 841690 842192 . + . gene_id "ENSG00000137090"; transcript_id "ENST00000382276"; exon_number "1"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 841690 842192 . + . gene_id "ENSG00000137090"; transcript_id "ENST00000564322"; exon_number "1"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu transcript 842714 968515 . + . gene_id "ENSG00000137090"; transcript_id "ENST00000569227"; NDR "NA"; txScore ""; txScore.noFit ""; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 842714 842954 . + . gene_id "ENSG00000137090"; transcript_id "ENST00000569227"; exon_number "1"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 846960 847143 . + . gene_id "ENSG00000137090"; transcript_id "ENST00000382276"; exon_number "2"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 846960 847143 . + . gene_id "ENSG00000137090"; transcript_id "ENST00000564322"; exon_number "2"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 846960 847143 . + . gene_id "ENSG00000137090"; transcript_id "ENST00000569227"; exon_number "2"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 893912 894195 . + . gene_id "ENSG00000137090"; transcript_id "ENST00000382276"; exon_number "3"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 893912 894985 . + . gene_id "ENSG00000137090"; transcript_id "ENST00000564322"; exon_number "3"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 893912 894195 . + . gene_id "ENSG00000137090"; transcript_id "ENST00000569227"; exon_number "3"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 916763 916907 . + . gene_id "ENSG00000137090"; transcript_id "ENST00000382276"; exon_number "4"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 916763 916907 . + . gene_id "ENSG00000137090"; transcript_id "ENST00000569227"; exon_number "4"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 967985 969090 . + . gene_id "ENSG00000137090"; transcript_id "ENST00000382276"; exon_number "5"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 967985 968515 . + . gene_id "ENSG00000137090"; transcript_id "ENST00000569227"; exon_number "5"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu transcript 976964 991731 . + . gene_id "ENSG00000064218"; transcript_id "ENST00000190165"; NDR "NA"; txScore ""; txScore.noFit ""; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 976964 977455 . + . gene_id "ENSG00000064218"; transcript_id "ENST00000190165"; exon_number "1"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu transcript 989837 990333 . + . gene_id "ENSG00000064218"; transcript_id "ENST00000417254"; NDR "NA"; txScore ""; txScore.noFit ""; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 989837 990333 . + . gene_id "ENSG00000064218"; transcript_id "ENST00000417254"; exon_number "1"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 990041 991731 . + . gene_id "ENSG00000064218"; transcript_id "ENST00000190165"; exon_number "2"; NDR "NA"; maxTxScore "NA"; maxTxScore.noFit "NA"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; diff --git a/output/combined_extended_annotations_novelTranscripts.gtf b/output/combined_extended_annotations_novelTranscripts.gtf deleted file mode 100644 index 28f6d05..0000000 --- a/output/combined_extended_annotations_novelTranscripts.gtf +++ /dev/null @@ -1,49 +0,0 @@ -9 Bambu transcript 121038 179058 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000356521"; NDR "0.790184378623962"; txScore ""; txScore.noFit ""; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 121038 121573 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000356521"; exon_number "15"; NDR "0.790184378623962"; maxTxScore "0.209815621376038"; maxTxScore.noFit "0.209815621376038"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu transcript 121409 179021 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000382447"; NDR "1"; txScore ""; txScore.noFit ""; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 121409 121573 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000382447"; exon_number "14"; NDR "1"; maxTxScore "-1"; maxTxScore.noFit "-1"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 121961 122090 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000356521"; exon_number "14"; NDR "0.790184378623962"; maxTxScore "0.209815621376038"; maxTxScore.noFit "0.209815621376038"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 121961 122090 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000382447"; exon_number "13"; NDR "1"; maxTxScore "-1"; maxTxScore.noFit "-1"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 123217 123282 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000356521"; exon_number "13"; NDR "0.790184378623962"; maxTxScore "0.209815621376038"; maxTxScore.noFit "0.209815621376038"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 123217 123282 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000382447"; exon_number "12"; NDR "1"; maxTxScore "-1"; maxTxScore.noFit "-1"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 123386 123454 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000356521"; exon_number "12"; NDR "0.790184378623962"; maxTxScore "0.209815621376038"; maxTxScore.noFit "0.209815621376038"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 123386 123454 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000382447"; exon_number "11"; NDR "1"; maxTxScore "-1"; maxTxScore.noFit "-1"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 134979 135030 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000356521"; exon_number "11"; NDR "0.790184378623962"; maxTxScore "0.209815621376038"; maxTxScore.noFit "0.209815621376038"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 134979 135030 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000382447"; exon_number "10"; NDR "1"; maxTxScore "-1"; maxTxScore.noFit "-1"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 146102 146158 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000356521"; exon_number "10"; NDR "0.790184378623962"; maxTxScore "0.209815621376038"; maxTxScore.noFit "0.209815621376038"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 152034 152078 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000356521"; exon_number "9"; NDR "0.790184378623962"; maxTxScore "0.209815621376038"; maxTxScore.noFit "0.209815621376038"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 152034 152078 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000382447"; exon_number "9"; NDR "1"; maxTxScore "-1"; maxTxScore.noFit "-1"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu transcript 152914 179025 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000377447"; NDR "0.653861284255981"; txScore ""; txScore.noFit ""; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 152914 154795 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000377447"; exon_number "8"; NDR "0.653861284255981"; maxTxScore "0.346138715744019"; maxTxScore.noFit "0.346138715744019"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 154709 154795 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000356521"; exon_number "8"; NDR "0.790184378623962"; maxTxScore "0.209815621376038"; maxTxScore.noFit "0.209815621376038"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 154709 154795 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000382447"; exon_number "8"; NDR "1"; maxTxScore "-1"; maxTxScore.noFit "-1"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 156481 156527 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000356521"; exon_number "7"; NDR "0.790184378623962"; maxTxScore "0.209815621376038"; maxTxScore.noFit "0.209815621376038"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 156481 156527 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000377447"; exon_number "7"; NDR "0.653861284255981"; maxTxScore "0.346138715744019"; maxTxScore.noFit "0.346138715744019"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 156481 156527 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000382447"; exon_number "7"; NDR "1"; maxTxScore "-1"; maxTxScore.noFit "-1"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 162432 162469 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000356521"; exon_number "6"; NDR "0.790184378623962"; maxTxScore "0.209815621376038"; maxTxScore.noFit "0.209815621376038"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 162432 162469 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000377447"; exon_number "6"; NDR "0.653861284255981"; maxTxScore "0.346138715744019"; maxTxScore.noFit "0.346138715744019"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 162432 162469 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000382447"; exon_number "6"; NDR "1"; maxTxScore "-1"; maxTxScore.noFit "-1"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 163978 164037 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000356521"; exon_number "5"; NDR "0.790184378623962"; maxTxScore "0.209815621376038"; maxTxScore.noFit "0.209815621376038"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 163978 164037 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000377447"; exon_number "5"; NDR "0.653861284255981"; maxTxScore "0.346138715744019"; maxTxScore.noFit "0.346138715744019"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 163978 164037 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000382447"; exon_number "5"; NDR "1"; maxTxScore "-1"; maxTxScore.noFit "-1"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu transcript 171953 179023 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000382389"; NDR "1"; txScore ""; txScore.noFit ""; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu transcript 171953 179045 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000382393"; NDR "0.281998038291931"; txScore ""; txScore.noFit ""; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 171953 173366 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000382389"; exon_number "4"; NDR "1"; maxTxScore "-1"; maxTxScore.noFit "-1"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 171953 173366 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000382393"; exon_number "3"; NDR "0.281998038291931"; maxTxScore "0.718001961708069"; maxTxScore.noFit "0.718001961708069"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 172081 172172 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000356521"; exon_number "4"; NDR "0.790184378623962"; maxTxScore "0.209815621376038"; maxTxScore.noFit "0.209815621376038"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 172081 172172 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000377447"; exon_number "4"; NDR "0.653861284255981"; maxTxScore "0.346138715744019"; maxTxScore.noFit "0.346138715744019"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 172081 172172 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000382447"; exon_number "4"; NDR "1"; maxTxScore "-1"; maxTxScore.noFit "-1"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 173270 173366 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000356521"; exon_number "3"; NDR "0.790184378623962"; maxTxScore "0.209815621376038"; maxTxScore.noFit "0.209815621376038"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 173270 173366 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000377447"; exon_number "3"; NDR "0.653861284255981"; maxTxScore "0.346138715744019"; maxTxScore.noFit "0.346138715744019"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 173270 173366 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000382447"; exon_number "3"; NDR "1"; maxTxScore "-1"; maxTxScore.noFit "-1"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 175698 175784 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000356521"; exon_number "2"; NDR "0.790184378623962"; maxTxScore "0.209815621376038"; maxTxScore.noFit "0.209815621376038"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 175698 175784 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000377447"; exon_number "2"; NDR "0.653861284255981"; maxTxScore "0.346138715744019"; maxTxScore.noFit "0.346138715744019"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 175698 175784 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000382389"; exon_number "3"; NDR "1"; maxTxScore "-1"; maxTxScore.noFit "-1"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 175698 175784 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000382393"; exon_number "2"; NDR "0.281998038291931"; maxTxScore "0.718001961708069"; maxTxScore.noFit "0.718001961708069"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 175698 175784 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000382447"; exon_number "2"; NDR "1"; maxTxScore "-1"; maxTxScore.noFit "-1"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 177723 177820 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000382389"; exon_number "2"; NDR "1"; maxTxScore "-1"; maxTxScore.noFit "-1"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 178816 179058 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000356521"; exon_number "1"; NDR "0.790184378623962"; maxTxScore "0.209815621376038"; maxTxScore.noFit "0.209815621376038"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 178816 179025 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000377447"; exon_number "1"; NDR "0.653861284255981"; maxTxScore "0.346138715744019"; maxTxScore.noFit "0.346138715744019"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 178816 179023 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000382389"; exon_number "1"; NDR "1"; maxTxScore "-1"; maxTxScore.noFit "-1"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 178816 179045 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000382393"; exon_number "1"; NDR "0.281998038291931"; maxTxScore "0.718001961708069"; maxTxScore.noFit "0.718001961708069"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 178816 179021 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000382447"; exon_number "1"; NDR "1"; maxTxScore "-1"; maxTxScore.noFit "-1"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; diff --git a/output/combined_extended_annotations_supportedTranscriptModels.gtf b/output/combined_extended_annotations_supportedTranscriptModels.gtf deleted file mode 100644 index 28f6d05..0000000 --- a/output/combined_extended_annotations_supportedTranscriptModels.gtf +++ /dev/null @@ -1,49 +0,0 @@ -9 Bambu transcript 121038 179058 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000356521"; NDR "0.790184378623962"; txScore ""; txScore.noFit ""; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 121038 121573 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000356521"; exon_number "15"; NDR "0.790184378623962"; maxTxScore "0.209815621376038"; maxTxScore.noFit "0.209815621376038"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu transcript 121409 179021 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000382447"; NDR "1"; txScore ""; txScore.noFit ""; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 121409 121573 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000382447"; exon_number "14"; NDR "1"; maxTxScore "-1"; maxTxScore.noFit "-1"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 121961 122090 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000356521"; exon_number "14"; NDR "0.790184378623962"; maxTxScore "0.209815621376038"; maxTxScore.noFit "0.209815621376038"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 121961 122090 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000382447"; exon_number "13"; NDR "1"; maxTxScore "-1"; maxTxScore.noFit "-1"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 123217 123282 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000356521"; exon_number "13"; NDR "0.790184378623962"; maxTxScore "0.209815621376038"; maxTxScore.noFit "0.209815621376038"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 123217 123282 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000382447"; exon_number "12"; NDR "1"; maxTxScore "-1"; maxTxScore.noFit "-1"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 123386 123454 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000356521"; exon_number "12"; NDR "0.790184378623962"; maxTxScore "0.209815621376038"; maxTxScore.noFit "0.209815621376038"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 123386 123454 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000382447"; exon_number "11"; NDR "1"; maxTxScore "-1"; maxTxScore.noFit "-1"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 134979 135030 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000356521"; exon_number "11"; NDR "0.790184378623962"; maxTxScore "0.209815621376038"; maxTxScore.noFit "0.209815621376038"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 134979 135030 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000382447"; exon_number "10"; NDR "1"; maxTxScore "-1"; maxTxScore.noFit "-1"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 146102 146158 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000356521"; exon_number "10"; NDR "0.790184378623962"; maxTxScore "0.209815621376038"; maxTxScore.noFit "0.209815621376038"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 152034 152078 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000356521"; exon_number "9"; NDR "0.790184378623962"; maxTxScore "0.209815621376038"; maxTxScore.noFit "0.209815621376038"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 152034 152078 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000382447"; exon_number "9"; NDR "1"; maxTxScore "-1"; maxTxScore.noFit "-1"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu transcript 152914 179025 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000377447"; NDR "0.653861284255981"; txScore ""; txScore.noFit ""; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 152914 154795 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000377447"; exon_number "8"; NDR "0.653861284255981"; maxTxScore "0.346138715744019"; maxTxScore.noFit "0.346138715744019"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 154709 154795 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000356521"; exon_number "8"; NDR "0.790184378623962"; maxTxScore "0.209815621376038"; maxTxScore.noFit "0.209815621376038"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 154709 154795 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000382447"; exon_number "8"; NDR "1"; maxTxScore "-1"; maxTxScore.noFit "-1"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 156481 156527 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000356521"; exon_number "7"; NDR "0.790184378623962"; maxTxScore "0.209815621376038"; maxTxScore.noFit "0.209815621376038"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 156481 156527 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000377447"; exon_number "7"; NDR "0.653861284255981"; maxTxScore "0.346138715744019"; maxTxScore.noFit "0.346138715744019"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 156481 156527 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000382447"; exon_number "7"; NDR "1"; maxTxScore "-1"; maxTxScore.noFit "-1"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 162432 162469 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000356521"; exon_number "6"; NDR "0.790184378623962"; maxTxScore "0.209815621376038"; maxTxScore.noFit "0.209815621376038"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 162432 162469 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000377447"; exon_number "6"; NDR "0.653861284255981"; maxTxScore "0.346138715744019"; maxTxScore.noFit "0.346138715744019"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 162432 162469 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000382447"; exon_number "6"; NDR "1"; maxTxScore "-1"; maxTxScore.noFit "-1"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 163978 164037 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000356521"; exon_number "5"; NDR "0.790184378623962"; maxTxScore "0.209815621376038"; maxTxScore.noFit "0.209815621376038"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 163978 164037 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000377447"; exon_number "5"; NDR "0.653861284255981"; maxTxScore "0.346138715744019"; maxTxScore.noFit "0.346138715744019"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 163978 164037 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000382447"; exon_number "5"; NDR "1"; maxTxScore "-1"; maxTxScore.noFit "-1"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu transcript 171953 179023 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000382389"; NDR "1"; txScore ""; txScore.noFit ""; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu transcript 171953 179045 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000382393"; NDR "0.281998038291931"; txScore ""; txScore.noFit ""; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 171953 173366 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000382389"; exon_number "4"; NDR "1"; maxTxScore "-1"; maxTxScore.noFit "-1"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 171953 173366 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000382393"; exon_number "3"; NDR "0.281998038291931"; maxTxScore "0.718001961708069"; maxTxScore.noFit "0.718001961708069"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 172081 172172 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000356521"; exon_number "4"; NDR "0.790184378623962"; maxTxScore "0.209815621376038"; maxTxScore.noFit "0.209815621376038"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 172081 172172 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000377447"; exon_number "4"; NDR "0.653861284255981"; maxTxScore "0.346138715744019"; maxTxScore.noFit "0.346138715744019"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 172081 172172 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000382447"; exon_number "4"; NDR "1"; maxTxScore "-1"; maxTxScore.noFit "-1"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 173270 173366 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000356521"; exon_number "3"; NDR "0.790184378623962"; maxTxScore "0.209815621376038"; maxTxScore.noFit "0.209815621376038"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 173270 173366 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000377447"; exon_number "3"; NDR "0.653861284255981"; maxTxScore "0.346138715744019"; maxTxScore.noFit "0.346138715744019"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 173270 173366 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000382447"; exon_number "3"; NDR "1"; maxTxScore "-1"; maxTxScore.noFit "-1"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 175698 175784 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000356521"; exon_number "2"; NDR "0.790184378623962"; maxTxScore "0.209815621376038"; maxTxScore.noFit "0.209815621376038"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 175698 175784 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000377447"; exon_number "2"; NDR "0.653861284255981"; maxTxScore "0.346138715744019"; maxTxScore.noFit "0.346138715744019"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 175698 175784 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000382389"; exon_number "3"; NDR "1"; maxTxScore "-1"; maxTxScore.noFit "-1"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 175698 175784 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000382393"; exon_number "2"; NDR "0.281998038291931"; maxTxScore "0.718001961708069"; maxTxScore.noFit "0.718001961708069"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 175698 175784 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000382447"; exon_number "2"; NDR "1"; maxTxScore "-1"; maxTxScore.noFit "-1"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 177723 177820 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000382389"; exon_number "2"; NDR "1"; maxTxScore "-1"; maxTxScore.noFit "-1"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 178816 179058 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000356521"; exon_number "1"; NDR "0.790184378623962"; maxTxScore "0.209815621376038"; maxTxScore.noFit "0.209815621376038"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 178816 179025 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000377447"; exon_number "1"; NDR "0.653861284255981"; maxTxScore "0.346138715744019"; maxTxScore.noFit "0.346138715744019"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 178816 179023 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000382389"; exon_number "1"; NDR "1"; maxTxScore "-1"; maxTxScore.noFit "-1"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 178816 179045 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000382393"; exon_number "1"; NDR "0.281998038291931"; maxTxScore "0.718001961708069"; maxTxScore.noFit "0.718001961708069"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; -9 Bambu exon 178816 179021 . - . gene_id "ENSG00000172785"; transcript_id "ENST00000382447"; exon_number "1"; NDR "1"; maxTxScore "-1"; maxTxScore.noFit "-1"; novelGene "FALSE"; novelTranscript "FALSE"; txClassDescription "annotation"; diff --git a/output/combined_incompatibleCounts.mtx b/output/combined_incompatibleCounts.mtx deleted file mode 100644 index fd4fc1d..0000000 --- a/output/combined_incompatibleCounts.mtx +++ /dev/null @@ -1,49 +0,0 @@ -%%MatrixMarket matrix coordinate integer general -23 133 47 -22 9 1 -6 14 1 -6 16 1 -6 18 1 -7 19 2 -6 23 2 -6 27 1 -6 28 1 -6 29 1 -6 31 1 -6 32 1 -11 33 1 -6 39 2 -11 43 1 -6 44 1 -6 49 1 -6 50 1 -3 52 1 -3 53 1 -6 55 1 -6 56 1 -6 57 1 -6 58 1 -6 59 1 -6 63 1 -6 72 1 -6 73 1 -6 75 1 -6 80 1 -6 84 1 -2 87 1 -6 88 1 -6 90 2 -7 91 1 -6 93 1 -6 94 1 -6 100 1 -6 107 1 -6 108 1 -6 110 1 -6 115 1 -6 117 1 -3 120 1 -3 121 1 -6 128 1 -6 129 1 -6 131 1 diff --git a/output/combined_sampleData.tsv b/output/combined_sampleData.tsv deleted file mode 100644 index 344bd53..0000000 --- a/output/combined_sampleData.tsv +++ /dev/null @@ -1,134 +0,0 @@ -id sampleName Barcode -Bambu_AAACGGGGTGCGATAG Bambu AAACGGGGTGCGATAG -Bambu_AAATGCCGTGACAAAT Bambu AAATGCCGTGACAAAT -Bambu_AACGTTGAGAGTAAGG Bambu AACGTTGAGAGTAAGG -Bambu_AAGGTTCGTGAAAGAG Bambu AAGGTTCGTGAAAGAG -Bambu_AATCCAGAGCGTAATA Bambu AATCCAGAGCGTAATA -Bambu_ACACCCTTCAAGGCTT Bambu ACACCCTTCAAGGCTT -Bambu_ACACTGAAGTTGAGAT Bambu ACACTGAAGTTGAGAT -Bambu_ACACTGATCTGTCTAT Bambu ACACTGATCTGTCTAT -Bambu_ACAGCTAAGCGTAGTG Bambu ACAGCTAAGCGTAGTG -Bambu_ACATACGTCGCTTGTC Bambu ACATACGTCGCTTGTC -Bambu_ACCAGTATCATATCGG Bambu ACCAGTATCATATCGG -Bambu_ACCGTAAAGTCAAGGC Bambu ACCGTAAAGTCAAGGC -Bambu_ACCGTAGAGTGTCCCG Bambu ACCGTAGAGTGTCCCG -Bambu_ACGATACCAGAAGCAC Bambu ACGATACCAGAAGCAC -Bambu_ACGGCCACACAGCCCA Bambu ACGGCCACACAGCCCA -Bambu_AGATTGCCAATGCCAT Bambu AGATTGCCAATGCCAT -Bambu_AGCAGCCGTAAATGAC Bambu AGCAGCCGTAAATGAC -Bambu_AGCGTCGCAATGCCAT Bambu AGCGTCGCAATGCCAT -Bambu_AGCTTGACATCAGTCA Bambu AGCTTGACATCAGTCA -Bambu_AGGCCGTGTAAACCTC Bambu AGGCCGTGTAAACCTC -Bambu_AGGGAGTAGAAGGACA Bambu AGGGAGTAGAAGGACA -Bambu_AGGTCCGAGTCGATAA Bambu AGGTCCGAGTCGATAA -Bambu_ATAACGCGTAGGAGTC Bambu ATAACGCGTAGGAGTC -Bambu_ATCATGGGTAGAGGAA Bambu ATCATGGGTAGAGGAA -Bambu_ATCTGCCAGGATCGCA Bambu ATCTGCCAGGATCGCA -Bambu_ATGTGTGAGTTGTAGA Bambu ATGTGTGAGTTGTAGA -Bambu_ATTATCCGTGCATCTA Bambu ATTATCCGTGCATCTA -Bambu_ATTATCCGTTATCACG Bambu ATTATCCGTTATCACG -Bambu_ATTGGTGTAACCCGAG Bambu ATTGGTGTAACCCGAG -Bambu_CAACCAACATGATCCA Bambu CAACCAACATGATCCA -Bambu_CAAGAAAAGCTGATAA Bambu CAAGAAAAGCTGATAA -Bambu_CAAGATCAGAGTCTGG Bambu CAAGATCAGAGTCTGG -Bambu_CACAGTATCATTGCCC Bambu CACAGTATCATTGCCC -Bambu_CACATTTCAGACAGGT Bambu CACATTTCAGACAGGT -Bambu_CACCTTGAGTCCGTAT Bambu CACCTTGAGTCCGTAT -Bambu_CAGAATCTCGCATGAT Bambu CAGAATCTCGCATGAT -Bambu_CAGATCAAGCGTAATA Bambu CAGATCAAGCGTAATA -Bambu_CAGCAGCAGATCACGG Bambu CAGCAGCAGATCACGG -Bambu_CAGCAGCTCAACCAAC Bambu CAGCAGCTCAACCAAC -Bambu_CAGCATATCCGTCAAA Bambu CAGCATATCCGTCAAA -Bambu_CAGCGACCAGACAAGC Bambu CAGCGACCAGACAAGC -Bambu_CATCAAGAGTCAAGGC Bambu CATCAAGAGTCAAGGC -Bambu_CCATGTCTCATCGCTC Bambu CCATGTCTCATCGCTC -Bambu_CCCTCCTTCTACGAGT Bambu CCCTCCTTCTACGAGT -Bambu_CCTTACGCAAATCCGT Bambu CCTTACGCAAATCCGT -Bambu_CGAACATCATATACGC Bambu CGAACATCATATACGC -Bambu_CGAATGTCAGTCGTGC Bambu CGAATGTCAGTCGTGC -Bambu_CGACTTCGTACCGTAT Bambu CGACTTCGTACCGTAT -Bambu_CGAGCCAAGCTATGCT Bambu CGAGCCAAGCTATGCT -Bambu_CGAGCCACATCCCATC Bambu CGAGCCACATCCCATC -Bambu_CGATGTAGTATCAGTC Bambu CGATGTAGTATCAGTC -Bambu_CGATGTAGTCGCTTCT Bambu CGATGTAGTCGCTTCT -Bambu_CGCCAAGCATCCCACT Bambu CGCCAAGCATCCCACT -Bambu_CGCGGTATCGCGTTTC Bambu CGCGGTATCGCGTTTC -Bambu_CGGACTGAGTCTCGGC Bambu CGGACTGAGTCTCGGC -Bambu_CGGTTAAAGCACGCCT Bambu CGGTTAAAGCACGCCT -Bambu_CGTAGGCTCTTCGGTC Bambu CGTAGGCTCTTCGGTC -Bambu_CGTGTCTTCTCAAGTG Bambu CGTGTCTTCTCAAGTG -Bambu_CTAATGGAGTCTCCTC Bambu CTAATGGAGTCTCCTC -Bambu_CTAATGGGTGAAGGCT Bambu CTAATGGGTGAAGGCT -Bambu_CTACACCCAGAGCCAA Bambu CTACACCCAGAGCCAA -Bambu_CTACATTGTTACGGAG Bambu CTACATTGTTACGGAG -Bambu_CTCGGAGTCTAGCACA Bambu CTCGGAGTCTAGCACA -Bambu_CTCGTACGTTTGCATG Bambu CTCGTACGTTTGCATG -Bambu_CTGAAACCAATGTAAG Bambu CTGAAACCAATGTAAG -Bambu_CTGATCCTCTATCGCC Bambu CTGATCCTCTATCGCC -Bambu_CTGCCTATCACATAGC Bambu CTGCCTATCACATAGC -Bambu_CTGGTCTGTCGGCACT Bambu CTGGTCTGTCGGCACT -Bambu_CTGTGCTAGAATCTCC Bambu CTGTGCTAGAATCTCC -Bambu_CTGTGCTTCCTAGAAC Bambu CTGTGCTTCCTAGAAC -Bambu_CTTAACTTCTAACTGG Bambu CTTAACTTCTAACTGG -Bambu_GAATAAGTCTTTACGT Bambu GAATAAGTCTTTACGT -Bambu_GACGTTACAAAGAATC Bambu GACGTTACAAAGAATC -Bambu_GACTACAGTTCGGCAC Bambu GACTACAGTTCGGCAC -Bambu_GACTGCGTCGGCCGAT Bambu GACTGCGTCGGCCGAT -Bambu_GAGCAGACATCGGAAG Bambu GAGCAGACATCGGAAG -Bambu_GATCAGTGTCATATCG Bambu GATCAGTGTCATATCG -Bambu_GCATACAAGCGAGAAA Bambu GCATACAAGCGAGAAA -Bambu_GCGAGAACAATCACAC Bambu GCGAGAACAATCACAC -Bambu_GCGCCAATCCTCTAGC Bambu GCGCCAATCCTCTAGC -Bambu_GCGGGTTTCGTATCAG Bambu GCGGGTTTCGTATCAG -Bambu_GCTGCAGCACTTAAGC Bambu GCTGCAGCACTTAAGC -Bambu_GCTGCTTCATTCCTGC Bambu GCTGCTTCATTCCTGC -Bambu_GGATGTTAGGCCGAAT Bambu GGATGTTAGGCCGAAT -Bambu_GGATTACAGTCAATAG Bambu GGATTACAGTCAATAG -Bambu_GGATTACAGTTCGATC Bambu GGATTACAGTTCGATC -Bambu_GGATTACTCTGCAGTA Bambu GGATTACTCTGCAGTA -Bambu_GGATTACTCTTCGAGA Bambu GGATTACTCTTCGAGA -Bambu_GGCAATTAGATCGGGT Bambu GGCAATTAGATCGGGT -Bambu_GGCAATTAGTGAAGAG Bambu GGCAATTAGTGAAGAG -Bambu_GGGAGATGTACTTAGC Bambu GGGAGATGTACTTAGC -Bambu_GTACGTATCAAGGCTT Bambu GTACGTATCAAGGCTT -Bambu_GTACTCCTCATGTCCC Bambu GTACTCCTCATGTCCC -Bambu_GTAGTCATCCCTCTTT Bambu GTAGTCATCCCTCTTT -Bambu_GTCACGGGTCGTCTTC Bambu GTCACGGGTCGTCTTC -Bambu_GTCCTCGATCACCGGG Bambu GTCCTCGATCACCGGG -Bambu_GTCTCGTCATGAACCT Bambu GTCTCGTCATGAACCT -Bambu_GTCTCGTTCGGCGCAT Bambu GTCTCGTTCGGCGCAT -Bambu_GTGAAGGGTTCTGTTT Bambu GTGAAGGGTTCTGTTT -Bambu_GTGTGCGCAGTCGTGC Bambu GTGTGCGCAGTCGTGC -Bambu_GTTACAGAGAAACCTA Bambu GTTACAGAGAAACCTA -Bambu_GTTTCTAAGCGTGAGT Bambu GTTTCTAAGCGTGAGT -Bambu_TAAGCGTCAAAGGAAG Bambu TAAGCGTCAAAGGAAG -Bambu_TAAGTGCTCTACTCAT Bambu TAAGTGCTCTACTCAT -Bambu_TACCTTAGTTAAAGAC Bambu TACCTTAGTTAAAGAC -Bambu_TACGGGCTCACCCTCA Bambu TACGGGCTCACCCTCA -Bambu_TACTTACCAAGACGTG Bambu TACTTACCAAGACGTG -Bambu_TAGACCAGTATCTGCA Bambu TAGACCAGTATCTGCA -Bambu_TATTACCCACTCGACG Bambu TATTACCCACTCGACG -Bambu_TCAATCTCAGCGATCC Bambu TCAATCTCAGCGATCC -Bambu_TCAGATGTCACCAGGC Bambu TCAGATGTCACCAGGC -Bambu_TCAGCTCGTGTCTGAT Bambu TCAGCTCGTGTCTGAT -Bambu_TCATTACTCCACGAAT Bambu TCATTACTCCACGAAT -Bambu_TCATTTGTCTGGAGCC Bambu TCATTTGTCTGGAGCC -Bambu_TCATTTGTCTGGTATG Bambu TCATTTGTCTGGTATG -Bambu_TCCACACGTGCTTCTC Bambu TCCACACGTGCTTCTC -Bambu_TCGCGTTTCGTTACAG Bambu TCGCGTTTCGTTACAG -Bambu_TCGTAGAGTAGGCATG Bambu TCGTAGAGTAGGCATG -Bambu_TCTATTGAGTCAAGGC Bambu TCTATTGAGTCAAGGC -Bambu_TCTCTAACAAGCTGGA Bambu TCTCTAACAAGCTGGA -Bambu_TCTGGAAAGGTGACCA Bambu TCTGGAAAGGTGACCA -Bambu_TGAAAGATCCCTCAGT Bambu TGAAAGATCCCTCAGT -Bambu_TGAGCATCAATGAATG Bambu TGAGCATCAATGAATG -Bambu_TGAGGGAGTAAAGGAG Bambu TGAGGGAGTAAAGGAG -Bambu_TGCTACCTCGTAGATC Bambu TGCTACCTCGTAGATC -Bambu_TGGCCAGAGTACGATG Bambu TGGCCAGAGTACGATG -Bambu_TGGGCGTGTTCGTGAT Bambu TGGGCGTGTTCGTGAT -Bambu_TGGTTAGTCCGGCACA Bambu TGGTTAGTCCGGCACA -Bambu_TGTGTTTGTTGGAGGT Bambu TGTGTTTGTTGGAGGT -Bambu_TTATGCTTCCTAAGTG Bambu TTATGCTTCCTAAGTG -Bambu_TTCTCAACAGATCCAT Bambu TTCTCAACAGATCCAT -Bambu_TTGACTTAGCTGCAAG Bambu TTGACTTAGCTGCAAG -Bambu_TTGCGTCCAGTAGAGC Bambu TTGCGTCCAGTAGAGC diff --git a/output/combined_se.rds b/output/combined_se.rds deleted file mode 100644 index 30fa3e4..0000000 Binary files a/output/combined_se.rds and /dev/null differ diff --git a/output/genes.tsv b/output/genes.tsv deleted file mode 100644 index 1600260..0000000 --- a/output/genes.tsv +++ /dev/null @@ -1,23 +0,0 @@ -ENSG00000064218 -ENSG00000107099 -ENSG00000107104 -ENSG00000137090 -ENSG00000170122 -ENSG00000172785 -ENSG00000181404 -ENSG00000183784 -ENSG00000202172 -ENSG00000218839 -ENSG00000226403 -ENSG00000227155 -ENSG00000227518 -ENSG00000227914 -ENSG00000227917 -ENSG00000228115 -ENSG00000229875 -ENSG00000231808 -ENSG00000235330 -ENSG00000235880 -ENSG00000236875 -ENSG00000277631 -ENSG00000283921 diff --git a/output/new_reads.fastq.gz b/output/new_reads.fastq.gz deleted file mode 100644 index 9871435..0000000 Binary files a/output/new_reads.fastq.gz and /dev/null differ diff --git a/output/txANDgenes.tsv b/output/txANDgenes.tsv deleted file mode 100644 index 0c94f0d..0000000 --- a/output/txANDgenes.tsv +++ /dev/null @@ -1,105 +0,0 @@ -ENST00000190165 ENSG00000064218 -ENST00000305248 ENSG00000218839 -ENST00000314367 ENSG00000172785 -ENST00000354485 ENSG00000107104 -ENST00000356521 ENSG00000172785 -ENST00000365302 ENSG00000202172 -ENST00000377400 ENSG00000172785 -ENST00000377447 ENSG00000172785 -ENST00000382276 ENSG00000137090 -ENST00000382286 ENSG00000107104 -ENST00000382289 ENSG00000107104 -ENST00000382293 ENSG00000107104 -ENST00000382297 ENSG00000107104 -ENST00000382303 ENSG00000107104 -ENST00000382329 ENSG00000107099 -ENST00000382331 ENSG00000107099 -ENST00000382341 ENSG00000107099 -ENST00000382387 ENSG00000183784 -ENST00000382389 ENSG00000172785 -ENST00000382393 ENSG00000172785 -ENST00000382447 ENSG00000172785 -ENST00000382500 ENSG00000170122 -ENST00000408365 ENSG00000283921 -ENST00000415004 ENSG00000227155 -ENST00000416242 ENSG00000231808 -ENST00000417254 ENSG00000064218 -ENST00000421436 ENSG00000229875 -ENST00000421620 ENSG00000236875 -ENST00000421645 ENSG00000227914 -ENST00000422679 ENSG00000227518 -ENST00000427318 ENSG00000227917 -ENST00000429661 ENSG00000235880 -ENST00000429980 ENSG00000277631 -ENST00000431099 ENSG00000172785 -ENST00000432829 ENSG00000107099 -ENST00000435421 ENSG00000227917 -ENST00000441028 ENSG00000226403 -ENST00000442069 ENSG00000277631 -ENST00000442442 ENSG00000228115 -ENST00000442898 ENSG00000181404 -ENST00000444793 ENSG00000226403 -ENST00000449442 ENSG00000218839 -ENST00000453981 ENSG00000107099 -ENST00000454469 ENSG00000107099 -ENST00000455592 ENSG00000235330 -ENST00000462513 ENSG00000172785 -ENST00000462618 ENSG00000107099 -ENST00000464198 ENSG00000172785 -ENST00000465014 ENSG00000172785 -ENST00000467541 ENSG00000107104 -ENST00000469197 ENSG00000107099 -ENST00000469391 ENSG00000107099 -ENST00000474772 ENSG00000107099 -ENST00000475411 ENSG00000172785 -ENST00000475690 ENSG00000107104 -ENST00000475990 ENSG00000172785 -ENST00000478380 ENSG00000107099 -ENST00000479404 ENSG00000107099 -ENST00000483757 ENSG00000107099 -ENST00000483817 ENSG00000172785 -ENST00000487230 ENSG00000107099 -ENST00000487575 ENSG00000172785 -ENST00000489272 ENSG00000172785 -ENST00000489369 ENSG00000107104 -ENST00000493666 ENSG00000107099 -ENST00000495184 ENSG00000107099 -ENST00000495302 ENSG00000172785 -ENST00000498044 ENSG00000172785 -ENST00000524396 ENSG00000107099 -ENST00000564322 ENSG00000137090 -ENST00000569227 ENSG00000137090 -ENST00000585631 ENSG00000227155 -ENST00000585819 ENSG00000227155 -ENST00000585944 ENSG00000227155 -ENST00000586805 ENSG00000227155 -ENST00000588474 ENSG00000227155 -ENST00000588989 ENSG00000227155 -ENST00000589287 ENSG00000227155 -ENST00000589387 ENSG00000227155 -ENST00000590240 ENSG00000227155 -ENST00000590518 ENSG00000227155 -ENST00000591577 ENSG00000227155 -ENST00000592805 ENSG00000227155 -ENST00000593137 ENSG00000227155 -ENST00000598100 ENSG00000235330 -ENST00000608097 ENSG00000227914 -ENST00000608617 ENSG00000227155 -ENST00000611457 ENSG00000172785 -ENST00000612045 ENSG00000172785 -ENST00000613355 ENSG00000172785 -ENST00000613372 ENSG00000277631 -ENST00000613508 ENSG00000172785 -ENST00000613988 ENSG00000172785 -ENST00000614900 ENSG00000277631 -ENST00000616803 ENSG00000172785 -ENST00000616944 ENSG00000172785 -ENST00000618061 ENSG00000172785 -ENST00000618361 ENSG00000172785 -ENST00000619157 ENSG00000172785 -ENST00000619269 ENSG00000107104 -ENST00000620292 ENSG00000172785 -ENST00000620326 ENSG00000277631 -ENST00000621255 ENSG00000277631 -ENST00000622412 ENSG00000277631 -ENST00000628764 ENSG00000227155 diff --git a/subworkflows/alignment.nf b/subworkflows/alignment.nf new file mode 100644 index 0000000..ae9286e --- /dev/null +++ b/subworkflows/alignment.nf @@ -0,0 +1,91 @@ +process MINIMAP_BUILD_INDEX{ + container "community.wave.seqera.io/library/minimap2_samtools:b09096fc890429ce" + label "low_cpu" + label "medium_mem" + label "short" + + input: + path(genome) + + output: + path('ref.mmi') + + script: + """ + minimap2 -k15 -w5 -d ref.mmi $genome # -k and -w flags are used for both splice:hq and splice presets + """ +} + +process PAFTOOLS_GFF2BED { + container "community.wave.seqera.io/library/minimap2_samtools:b09096fc890429ce" + label "low_cpu" + label "low_mem" + label "short" + + input: + path(gtf) + + output: + path('anno.bed') + + script: + """ + paftools.js gff2bed $gtf > anno.bed + """ +} + +process MINIMAP_ALIGNMENT{ + publishDir "${params.output_dir}/bam", mode: 'copy' + container "community.wave.seqera.io/library/minimap2_samtools:b09096fc890429ce" + label "high_cpu" + label "high_mem" + label "long" + + input: + tuple val(sample), path(newfastq), val(meta) + path(ref_mmi) + path(bed) + + output: + tuple val(sample), path("${sample}_demultiplexed.bam"), val(meta), emit: bam + path("${sample}_demultiplexed.bam.bai") + + script: + """ + if [[ $meta.technology == "PacBio" ]]; then + preset="splice:hq" + else + preset="splice" + fi + + minimap2 -ax \$preset -uf --junc-bed $bed -t $task.cpus $ref_mmi $newfastq > demultiplexed.sam + samtools sort -@ $task.cpus demultiplexed.sam -o ${sample}_demultiplexed.bam + samtools index -@ $task.cpus ${sample}_demultiplexed.bam + + rm demultiplexed.sam + """ +} + +workflow ALIGNMENT { + take: + ch_unaligned_fastq + ch_genome + ch_annotation + + main: + // ch_gate emits one item if fastq channel is non-empty, else emits nothing. Used to prevent MINIMAP_BUILD_INDEX and PAFTOOLS_GFF2BED + // from running when there are no fastq samples to process + ch_gate = ch_unaligned_fastq.first() + + // Build minimap2 index based on reference genome + MINIMAP_BUILD_INDEX(ch_genome.combine(ch_gate).map { g, _ -> g }) + + // Convert gtf/gff annotation to bed format + PAFTOOLS_GFF2BED(ch_annotation.combine(ch_gate).map { a, _ -> a }) + + // Minimap alignment + MINIMAP_ALIGNMENT(ch_unaligned_fastq, MINIMAP_BUILD_INDEX.out, PAFTOOLS_GFF2BED.out) + + emit: + bam = MINIMAP_ALIGNMENT.out.bam +} \ No newline at end of file diff --git a/subworkflows/prepare_input_standard.nf b/subworkflows/prepare_input_standard.nf new file mode 100644 index 0000000..89ae15d --- /dev/null +++ b/subworkflows/prepare_input_standard.nf @@ -0,0 +1,114 @@ +process EXTRACT_10X_BARCODES { + executor 'local' + container "quay.io/nf-core/spaceranger:9c5e7dc93c32448e" + + input: + val(chemistry) + path(barcode_coordinate_config) + + output: + tuple val(chemistry), path("${chemistry}_barcode.txt") + + script: + """ + # extract 10x barcode file path from config csv + IFS=',' read -r _ bc_filename _ < <(awk -F',' -v chem=$chemistry '\$1 == chem' $barcode_coordinate_config) + + # extract 10x barcode file from spaceranger container (used for subsequent processes) + if [[ \$bc_filename == *.gz ]]; then + gunzip -c $params.cellranger_dir/\$bc_filename > ./${chemistry}_barcode.txt + else + cp $params.cellranger_dir/\$bc_filename ./${chemistry}_barcode.txt + fi + """ +} + +process EXTRACT_10X_SPATIAL_COORDINATES { + executor 'local' + container "quay.io/nf-core/spaceranger:9c5e7dc93c32448e" + + input: + val(chemistry) + path(barcode_coordinate_config) + + output: + tuple val(chemistry), path("${chemistry}_spatial_coordinates.txt") + + script: + """ + # extract spatial coordinate file path from config csv + IFS=',' read -r _ _ sc_filename < <(awk -F',' -v chem=$chemistry '\$1 == chem' $barcode_coordinate_config) + + # extract spatial coordinate file from spaceranger container (used for subsequent processes) + # TODO: All visium coordinates file are not gzipped. In the future if there are gzipped files, include decompression) + if [[ $chemistry == visium* ]]; then + cp $params.cellranger_dir/\$sc_filename ./${chemistry}_spatial_coordinates.txt + sed -i '1ibarcode\tx_coordinate\ty_coordinate' ./${chemistry}_spatial_coordinates.txt # adding header to spatial coordinates file as it is required for bambu + else + touch ./${chemistry}_spatial_coordinates.txt # create empty file for non-visium chemistries + fi + """ +} + +workflow PREPARE_INPUT_STANDARD { + take: + ch_rows + ch_barcode_coordinate_config + + main: + // parse samplesheet rows into channel of tuples (sample, path, metadata) + ch_samples = ch_rows.map { row -> + // validate required columns exist and are non-empty + ["sample", "path"].each { col -> + if (!row.containsKey(col)) + error "Samplesheet is missing a required '${col}' column" + if (!row[col]) + error "A row in the samplesheet has an empty '${col}' value" + } + + def sample_path = file(row.path, checkIfExists: true) + + // resolve chemistry and technology from row or params, then validate + def valid_options = [chemistry: params.valid_chemistries, technology: params.valid_technologies] + def meta = valid_options.collectEntries { col, valid_list -> + def val = row.containsKey(col) ? row[col] : params[col] + if (!val) + error "Sample '${row.sample}' is missing a ${col} — set it in the samplesheet or via params.${col}" + if (!valid_list.contains(val)) + error "Sample '${row.sample}' has invalid ${col} '${val}' — must be one of: ${valid_list.join(', ')}" + [col, val] + } + + [row.sample, sample_path, meta] + } + + // extract distinct chemistries from metadata + ch_unique_chem = ch_samples.map { sample, path, meta -> meta.chemistry }.unique() + + // extract 10x barcodes and spatial coordinates for each chemistry (copy files from spaceranger container) + EXTRACT_10X_BARCODES(ch_unique_chem, ch_barcode_coordinate_config) + EXTRACT_10X_SPATIAL_COORDINATES(ch_unique_chem, ch_barcode_coordinate_config) + + // update metadata with barcode and spatial coordinate paths + ch_updated_samples = ch_samples.map { sample, path, meta -> [meta.chemistry, sample, path, meta] } + .combine(EXTRACT_10X_BARCODES.out, by: 0) + .combine(EXTRACT_10X_SPATIAL_COORDINATES.out, by: 0) + .map { chem, sample, path, meta, bc, sc -> + def updated_meta = meta + [ + barcode: bc, + spatial_metadata: sc + ] + return [sample, path, updated_meta] + } + + // split samples by file type + def fastq_exts = ['.fastq', '.fq', '.fastq.gz', '.fq.gz'] + ch_fastq = ch_updated_samples.filter { sample, path, meta -> fastq_exts.any { ext -> path.name.endsWith(ext) } } + ch_bam = ch_updated_samples.filter { sample, path, meta -> path.name.endsWith('.bam') } + ch_rds = ch_updated_samples.filter { sample, path, meta -> path.name.endsWith('.rds') } + + emit: + fastq = ch_fastq + bam = ch_bam + rds = ch_rds +} \ No newline at end of file