Merge pull request #9 from datacarpentry/gh-pages

update my fork

Author: ErinBecker

_episodes/01-introduction.md

@@ -196,19 +196,14 @@ Let's look at how our file system is organized.
 At the top is our `dcuser` directory, which holds all the 
 subdirectories and files.
 
-Inside that directory are several other directories:
-`dc_sample_data`
-`dc_workshop`
-`Desktop`
-`Downloads`
-`FastQC`  
-`openrefine-2-6-beta.1`
-`R`
-and
-`Trimmomatic-0.32`
+Inside that directory are some other directories:
 
-We'll be working with many of these subdirectories throughout this workshop.  
+~~~
+dc_sample_data	FastQC	Trimmomatic-0.32
+~~~
+{: .output}
 
+We'll be working with these subdirectories throughout this workshop.  
 
 The command to change locations in our file system is `cd` followed by a
 directory name to change our working directory.
@@ -222,7 +217,7 @@ $ cd dc_sample_data
 ~~~
 {: .bash}
 
-We can see files and subdirectores are in this directory by running `ls`,
+We can see files and subdirectories are in this directory by running `ls`,
 which stands for "listing":
 
 ~~~
@@ -231,7 +226,7 @@ $ ls
 {: .bash}
 
 ~~~
-r_genomics  sra_metadata  untrimmed_fastq  variant_calling  variant_calling.tar.gz
+sra_metadata  untrimmed_fastq
 ~~~
 {: .output}
 
@@ -247,13 +242,12 @@ $ ls -F
 {: .bash}
 
 ~~~
-r_genomics/  sra_metadata/  untrimmed_fastq/  variant_calling/	variant_calling.tar.gz
+sra_metadata/  untrimmed_fastq/
 ~~~
 {: .output}
 
-Anything with a "/" after it is a directory.  
-Things with a "*" after them are programs.  
-If there are no decorations, it's a file.
+Anything with a "/" after it is a directory. Things with a "*" after them are programs. If
+there are no decorations, it's a file.
 
 `ls` has lots of other options. To find out what they are, we can type:
 
@@ -279,10 +273,8 @@ to quit.
 > > {: .bash}
 > > 
 > > ~~~
-> > drwxrwxr-x 4 dcuser dcuser     4096 May 21  2016 r_genomics
-> > drwxr-x--- 2 dcuser dcuser     4096 Jul 30  2015 sra_metadata
-> > drwxr-xr-x 2 dcuser dcuser     4096 Jul 30  2015 untrimmed_fastq
-> > -rw-rw-r-- 1 dcuser dcuser 64281061 Jul 31  2015 variant_calling.tar.gz
+> > drwxr-x--- 2 dcuser dcuser 4096 Jul 30  2015 sra_metadata
+> > drwxr-xr-x 2 dcuser dcuser 4096 Jul 30  2015 untrimmed_fastq
 > > ~~~
 > > {: .output}
 > > 
@@ -340,9 +332,6 @@ $ cd untrimmed_fastq
 ~~~
 {: .bash}
 
-Notice that we can move two (or more) directory levels at a time by placing a `\` 
-between directory names.
-
 Using tab complete can be very helpful. However, it will only autocomplete
 a file or directory name if you've typed enough characters to provide
 a unique identifier for the file or directory you are trying to access.
@@ -351,6 +340,7 @@ If we navigate back to our `untrimmed_fastq` directory and try to access one
 of our sample files:
 
 ~~~
+$ cd
 $ cd dc_sample_data
 $ cd untrimmed_fastq
 $ ls SR<tab>

_episodes/02-the-filesystem.md

@@ -24,9 +24,16 @@ We've also learned how to use `cd` to change locations and `ls` to list the cont
 of a directory. Now we're going to learn some additional commands for moving around 
 within our file system.
 
-Use the commands we've learned so far to navigate to the `dc_sample_data` directory, if
+Use the commands we've learned so far to navigate to the `dc_sample_data/untrimmed_fastq` directory, if
 you're not already there. 
 
+~~~
+$ cd
+$ cd dc_sample_data
+$ cd untrimmed_fastq
+~~~
+{: .bash}
+
 What if we want to move back up and out of this directory and to our top level 
 directory? Can we type `cd dc_sample_data`? Try it and see what happens.
 
@@ -71,7 +78,7 @@ $ ls
 {: .bash}
 
 ~~~
-r_genomics  sra_metadata  untrimmed_fastq  variant_calling.tar.gz
+sra_metadata  untrimmed_fastq
 ~~~
 {: .output}
 
@@ -84,7 +91,7 @@ $ ls ../../
 ~~~
 {: .bash}
 
-prints the contents of `/home`, which is one level up from your home directory. 
+prints the contents of `/home`, which is one level up from your root directory. 
 
 > ## Finding hidden directories
 >
@@ -111,7 +118,7 @@ prints the contents of `/home`, which is one level up from your home directory.
 > > {: .bash}
 > > 
 > > ~~~
-> > .  ..  .hidden	r_genomics  sra_metadata  untrimmed_fastq  variant_calling.tar.gz
+> > .  ..  .hidden	sra_metadata  untrimmed_fastq
 > > ~~~
 > > {: .output}
 > > 
@@ -160,7 +167,7 @@ $ ls dc_sample_data
 {: .bash}
 
 ~~~
-r_genomics  sra_metadata  untrimmed_fastq  variant_calling.tar.gz
+sra_metadata  untrimmed_fastq
 ~~~
 {: .output}
 
@@ -315,6 +322,11 @@ $ ls ~
 ~~~
 {: .bash}
 
+~~~
+dc_sample_data	FastQC	Trimmomatic-0.32
+~~~
+{: .output}
+
 This prints the contents of your home directory, without you needing to 
 type the full path. 
 

_episodes/03-working-with-files.md

@@ -87,6 +87,11 @@ $ ls /usr/bin/*.sh
 ~~~
 {: .bash}
 
+~~~
+/usr/bin/amuFormat.sh  /usr/bin/gettext.sh  /usr/bin/gvmap.sh
+~~~
+{: .output}
+
 Lists every file in `/usr/bin` that ends in the characters `.sh`.
 
 > ## Home vs. Root
@@ -207,7 +212,7 @@ This will print out all of the contents of the `SRR098026.fastq` to the screen.
 > 
 > > ## Solution
 > > 1. The last line of the file is `TATTTTAAAATGGAATACCTAACATGTTAATTAACC`.
-> > 2. cat ~/dc_sample_data/untrimmed_fastq/*
+> > 2. `cat ~/dc_sample_data/untrimmed_fastq/*`
 > {: .solution}
 {: .challenge}
 
@@ -253,10 +258,10 @@ return, you will search backwards and move up the file to previous examples of t
 
 > ## Exercise
 >
-> What are the next three nucleotides (characters) after the sequence quoted above?
+> What are the next three nucleotides (characters) after the first instance of the sequence quoted above?
 > 
 > > ## Solution
-> > `TCA`
+> > `CAC`
 > {: .solution}
 {: .challenge}
 
@@ -273,20 +278,65 @@ the beginning and end of a file, respectively.
 
 ~~~
 $ head SRR098026.fastq
+~~~
+{: .bash}
+
+~~~
+@SRR098026.1 HWUSI-EAS1599_1:2:1:0:968 length=35
+NNNNNNNNNNNNNNNNCNNNNNNNNNNNNNNNNNN
++SRR098026.1 HWUSI-EAS1599_1:2:1:0:968 length=35
+!!!!!!!!!!!!!!!!#!!!!!!!!!!!!!!!!!!
+@SRR098026.2 HWUSI-EAS1599_1:2:1:0:312 length=35
+NNNNNNNNNNNNNNNNANNNNNNNNNNNNNNNNNN
++SRR098026.2 HWUSI-EAS1599_1:2:1:0:312 length=35
+!!!!!!!!!!!!!!!!#!!!!!!!!!!!!!!!!!!
+@SRR098026.3 HWUSI-EAS1599_1:2:1:0:570 length=35
+NNNNNNNNNNNNNNNNANNNNNNNNNNNNNNNNNN
+~~~
+{: .output}
+
+~~~
 $ tail SRR098026.fastq
 ~~~
 {: .bash}
 
+~~~
++SRR098026.247 HWUSI-EAS1599_1:2:1:2:1311 length=35
+#!##!#################!!!!!!!######
+@SRR098026.248 HWUSI-EAS1599_1:2:1:2:118 length=35
+GNTGNGGTCATCATACGCGCCCNNNNNNNGGCATG
++SRR098026.248 HWUSI-EAS1599_1:2:1:2:118 length=35
+B!;?!A=5922:##########!!!!!!!######
+@SRR098026.249 HWUSI-EAS1599_1:2:1:2:1057 length=35
+CNCTNTATGCGTACGGCAGTGANNNNNNNGGAGAT
++SRR098026.249 HWUSI-EAS1599_1:2:1:2:1057 length=35
+A!@B!BBB@ABAB#########!!!!!!!######
+~~~
+{: .output}
+
 The `-n` option to either of these commands can be used to print the
-first or last `n` lines of a file. To print the first/last line of the
-file use:
+first or last `n` lines of a file. 
 
 ~~~
 $ head -n 1 SRR098026.fastq
+~~~
+{: .bash}
+
+~~~
+@SRR098026.1 HWUSI-EAS1599_1:2:1:0:968 length=35
+~~~
+{: .output}
+
+~~~
 $ tail -n 1 SRR098026.fastq
 ~~~
 {: .bash}
 
+~~~
+A!@B!BBB@ABAB#########!!!!!!!######
+~~~
+{: .output}
+
 ## Creating, moving, copying, and removing
 
 Now we can move around in the file structure, look at files, search files, and
@@ -304,7 +354,7 @@ and change the file permissions so that we can read from, but not write to, the
 
 First, let's make a copy of one of our FASTQ files using the `cp` command. 
 
-Navigate to the `data` directory and enter:
+Navigate to the `dc_sample_data/untrimmed_fastq` directory and enter:
 
 ~~~
 $ cp SRR098026.fastq SRR098026-copy.fastq
@@ -374,7 +424,7 @@ $ ls -l
 {: .bash}
 
 ~~~
--rw-r--r-- 1 dcuser dcuser 43421 Jul 30 15:28 SRR098026-backup.fastq
+-rw-r--r-- 1 dcuser dcuser 43332 Nov 15 23:02 SRR098026-backup.fastq
 ~~~
 {: .output}
 
@@ -398,7 +448,7 @@ $ ls -l
 {: .bash}
 
 ~~~
--r--r--r-- 1 dcuser dcuser 43421 Jul 30 15:28 SRR098026-backup.fastq
+-r--r--r-- 1 dcuser dcuser 43332 Nov 15 23:02 SRR098026-backup.fastq
 ~~~
 {: .output}
 
@@ -407,14 +457,14 @@ $ ls -l
 To prove to ourselves that you no longer have the ability to modify this file, try deleting it with the `rm` command.
 
 ~~~
-$ rm backup/SRR098026-backup.fastq
+$ rm SRR098026-backup.fastq
 ~~~
 {: .bash}
 
 You'll be asked if you want to override your file permissions.
 
 ~~~
-override r--r--r-- dcuser/dcuser backup/SRR098026-backup.fastq?
+rm: remove write-protected regular file ‘SRR098026-backup.fastq’? 
 ~~~
 {: .output}
 
@@ -431,7 +481,8 @@ we just made.
 Enter the following command:
 
 ~~~
-rm -r backup
+$ cd ..
+$ rm -r backup
 ~~~
 {: .bash}
 
@@ -457,8 +508,8 @@ you will be asked whether you want to override your permission settings.
 > > It's always a good idea to check your work with `ls -l backup`. You should see something like: 
 > > 
 > > ~~~
-> > -r--r--r-- 1 dcuser dcuser 47649 Oct 20 16:59 SRR097977-backup.fastq
-> > -r--r--r-- 1 dcuser dcuser 43421 Oct 20 16:59 SRR098026-backup.fastq
+> > -r--r--r-- 1 dcuser dcuser 47552 Nov 15 23:06 SRR097977-backup.fastq
+> > -r--r--r-- 1 dcuser dcuser 43332 Nov 15 23:06 SRR098026-backup.fastq
 > > ~~~
 > > {: .output}
 > {: .solution}