CodExt is a (Python2-3 compatible) library that extends the native codecs library (namely for adding new custom encodings and character mappings) and provides 120+ new codecs, hence its name combining CODecs EXTension. It also features a guess mode for decoding multiple layers of encoding and CLI tools for convenience.
$ pip install codext| Want to contribute a new codec ? | Want to contribute a new macro ? |
|---|---|
| Check the documentation first Then PR your new codec |
PR your updated version of macros.json |
$ codext -i test.txt encode dna-1
GTGAGCGGGTATGTGA
$ echo -en "test" | codext encode morse
- . ... -
$ echo -en "test" | codext encode braille
⠞⠑⠎⠞
$ echo -en "test" | codext encode base100
👫👜👪👫
$ echo -en "Test string" | codext encode reverse
gnirts tseT
$ echo -en "Test string" | codext encode reverse morse
--. -. .. .-. - ... / - ... . -
$ echo -en "Test string" | codext encode reverse morse dna-2
AGTCAGTCAGTGAGAAAGTCAGTGAGAAAGTGAGTGAGAAAGTGAGTCAGTGAGAAAGTCAGAAAGTGAGTGAGTGAGAAAGTTAGAAAGTCAGAAAGTGAGTGAGTGAGAAAGTGAGAAAGTC
$ echo -en "Test string" | codext encode reverse morse dna-2 octal
101107124103101107124103101107124107101107101101101107124103101107124107101107101101101107124107101107124107101107101101101107124107101107124103101107124107101107101101101107124103101107101101101107124107101107124107101107124107101107101101101107124124101107101101101107124103101107101101101107124107101107124107101107124107101107101101101107124107101107101101101107124103
$ echo -en "AGTCAGTCAGTGAGAAAGTCAGTGAGAAAGTGAGTGAGAAAGTGAGTCAGTGAGAAAGTCAGAAAGTGAGTGAGTGAGAAAGTTAGAAAGTCAGAAAGTGAGTGAGTGAGAAAGTGAGAAAGTC" | codext -d dna-2 morse reverse
test string$ codext add-macro my-encoding-chain gzip base63 lzma base64
$ codext list macros
example-macro, my-encoding-chain
$ echo -en "Test string" | codext encode my-encoding-chain
CQQFAF0AAIAAABuTgySPa7WaZC5Sunt6FS0ko71BdrYE8zHqg91qaqadZIR2LafUzpeYDBalvE///ug4AA==
$ codext remove-macro my-encoding-chain
$ codext list macros
example-macro$ echo "Test string !" | base122
*.7!ft9�-f9Â
$ echo "Test string !" | base91
"ONK;WDZM%Z%xE7L
$ echo "Test string !" | base91 | base85
B2P|BJ6A+nO(j|-cttl%
$ echo "Test string !" | base91 | base85 | base36 | base58-flickr
QVx5tvgjvCAkXaMSuKoQmCnjeCV1YyyR3WErUUErFf
$ echo "Test string !" | base91 | base85 | base36 | base58-flickr | base58-flickr -d | base36 -d | base85 -d | base91 -d
Test string !
$ echo "Test string !" | base91 | base85 | base36 | base58-flickr | unbase -m 3
Test string !
$ echo "Test string !" | base91 | base85 | base36 | base58-flickr | unbase -f Test
Test string !
Getting the list of available codecs:
>>> import codext
>>> codext.list()
['ascii85', 'base85', 'base100', 'base122', ..., 'tomtom', 'dna', 'html', 'markdown', 'url', 'resistor', 'sms', 'whitespace', 'whitespace-after-before']
>>> codext.encode("this is a test", "base58-bitcoin")
'jo91waLQA1NNeBmZKUF'
>>> codext.encode("this is a test", "base58-ripple")
'jo9rA2LQwr44eBmZK7E'
>>> codext.encode("this is a test", "base58-url")
'JN91Wzkpa1nnDbLyjtf'
>>> codecs.encode("this is a test", "base100")
'👫👟👠👪🐗👠👪🐗👘🐗👫👜👪👫'
>>> codecs.decode("👫👟👠👪🐗👠👪🐗👘🐗👫👜👪👫", "base100")
'this is a test'
>>> for i in range(8):
print(codext.encode("this is a test", "dna-%d" % (i + 1)))
GTGAGCCAGCCGGTATACAAGCCGGTATACAAGCAGACAAGTGAGCGGGTATGTGA
CTCACGGACGGCCTATAGAACGGCCTATAGAACGACAGAACTCACGCCCTATCTCA
ACAGATTGATTAACGCGTGGATTAACGCGTGGATGAGTGGACAGATAAACGCACAG
AGACATTCATTAAGCGCTCCATTAAGCGCTCCATCACTCCAGACATAAAGCGAGAC
TCTGTAAGTAATTCGCGAGGTAATTCGCGAGGTAGTGAGGTCTGTATTTCGCTCTG
TGTCTAACTAATTGCGCACCTAATTGCGCACCTACTCACCTGTCTATTTGCGTGTC
GAGTGCCTGCCGGATATCTTGCCGGATATCTTGCTGTCTTGAGTGCGGGATAGAGT
CACTCGGTCGGCCATATGTTCGGCCATATGTTCGTCTGTTCACTCGCCCATACACT
>>> codext.decode("GTGAGCCAGCCGGTATACAAGCCGGTATACAAGCAGACAAGTGAGCGGGTATGTGA", "dna-1")
'this is a test'
>>> codecs.encode("this is a test", "morse")
'- .... .. ... / .. ... / .- / - . ... -'
>>> codecs.decode("- .... .. ... / .. ... / .- / - . ... -", "morse")
'this is a test'
>>> with open("morse.txt", 'w', encoding="morse") as f:
f.write("this is a test")
14
>>> with open("morse.txt",encoding="morse") as f:
f.read()
'this is a test'
>>> codext.decode("""
=
X
:
x
n
r
y
Y
y
p
a
`
n
|
a
o
h
`
g
o
z """, "whitespace-after+before")
'CSC{not_so_invisible}'
>>> print(codext.encode("An example test string", "baudot-tape"))
***.**
. *
***.*
* .
.*
* .*
. *
** .*
***.**
** .**
.*
* .
* *. *
.*
* *.
* *. *
* .
* *.
* *. *
***.
*.*
***.*
* .* -
base1: useless, but for the sake of completeness -
base2: simple conversion to binary (with a variant with a reversed alphabet) -
base3: conversion to ternary (with a variant with a reversed alphabet) -
base4: conversion to quarternary (with a variant with a reversed alphabet) -
base8: simple conversion to octal (with a variant with a reversed alphabet) -
base10: simple conversion to decimal -
base11: conversion to digits with a "a" -
base16: simple conversion to hexadecimal (with a variant holding an alphabet with digits and letters inverted) -
base26: conversion to alphabet letters -
base32: classical conversion according to the RFC4648 with all its variants (zbase32, extended hexadecimal, geohash, Crockford) -
base36: Base36 conversion to letters and digits (with a variant inverting both groups) -
base45: Base45 DRAFT algorithm (with a variant inverting letters and digits) -
base58: multiple versions of Base58 (bitcoin, flickr, ripple) -
base62: Base62 conversion to lower- and uppercase letters and digits (with a variant with letters and digits inverted) -
base63: similar tobase62with the "_" added -
base64: classical conversion according to RFC4648 with its variant URL (or file) (it also holds a variant with letters and digits inverted) -
base67: custom conversion using some more special characters (also with a variant with letters and digits inverted) -
base85: all variants of Base85 (Ascii85, z85, Adobe, (x)btoa, RFC1924, XML) -
base91: Base91 custom conversion -
base100(or emoji): Base100 custom conversion -
base122: Base100 custom conversion -
base-genericN: see base encodings ; supports any possible base
This category also contains ascii85, adobe, [x]btoa, zeromq with the base85 codec.
-
baudot: supports CCITT-1, CCITT-2, EU/FR, ITA1, ITA2, MTK-2 (Python3 only), UK, ... -
baudot-spaced: variant ofbaudot; groups of 5 bits are whitespace-separated -
baudot-tape: variant ofbaudot; outputs a string that looks like a perforated tape -
bcd: Binary Coded Decimal, encodes characters from their (zero-left-padded) ordinals -
bcd-extended0: variant ofbcd; encodes characters from their (zero-left-padded) ordinals using prefix bits0000 -
bcd-extended1: variant ofbcd; encodes characters from their (zero-left-padded) ordinals using prefix bits1111 -
excess3: uses Excess-3 (aka Stibitz code) binary encoding to convert characters from their ordinals -
gray: aka reflected binary code -
manchester: XORes each bit of the input with01 -
manchester-inverted: variant ofmanchester; XORes each bit of the input with10 -
rotateN: rotates characters by the specified number of bits (N belongs to [1, 7] ; Python 3 only)
-
adler: Adler32 algorithm (relies onzlib) -
crc: CRC of lengths 8, 10-17, 21, 24, 30-32, 40, 64, 82 with a variety of polynoms -
luhn: Luhn mod N algorithm
-
a1z26: keeps words whitespace-separated and uses a custom character separator -
cases: set of case-related encodings (including camel-, kebab-, lower-, pascal-, upper-, snake- and swap-case, slugify, capitalize, title) -
dummy: set of simple encodings (including integer, replace, reverse, word-reverse, substite and strip-spaces) -
octal: dummy octal conversion (converts to 3-digits groups) -
octal-spaced: variant ofoctal; dummy octal conversion, handling whitespace separators -
ordinal: dummy character ordinals conversion (converts to 3-digits groups) -
ordinal-spaced: variant ofordinal; dummy character ordinals conversion, handling whitespace separators
-
gzip: standard Gzip compression/decompression -
lz77: compresses the given data with the algorithm of Lempel and Ziv of 1977 -
lz78: compresses the given data with the algorithm of Lempel and Ziv of 1978 -
pkzip_deflate: standard Zip-deflate compression/decompression -
pkzip_bzip2: standard BZip2 compression/decompression -
pkzip_lzma: standard LZMA compression/decompression
⚠️ Compression functions are of course definitely NOT encoding functions ; they are implemented for leveraging the.encode(...)API fromcodecs.
-
affine: aka Affine Cipher -
atbash: aka Atbash Cipher -
bacon: aka Baconian Cipher -
barbie-N: aka Barbie Typewriter (N belongs to [1, 4]) -
citrix: aka Citrix CTX1 password encoding -
polybius: aka Polybius Square Cipher -
railfence: aka Rail Fence Cipher -
rotN: aka Caesar cipher (N belongs to [1,25]) -
scytaleN: encrypts using the number of letters on the rod (N belongs to [1,[) -
shiftN: shift ordinals (N belongs to [1,255]) -
vic-keyword-trans1[-trans2]: aka VIC Cipher -
vigenere: aka Vigenere Cipher -
xorN: XOR with a single byte (N belongs to [1,255])
⚠️ Crypto functions are of course definitely NOT encoding functions ; they are implemented for leveraging the.encode(...)API fromcodecs.
-
blake: includes BLAKE2b and BLAKE2s (Python 3 only ; relies onhashlib) -
crypt: Unix's crypt hash for passwords (Python 3 and Unix only ; relies oncrypt) -
md: aka Message Digest ; includes MD4 and MD5 (relies onhashlib) -
sha: aka Secure Hash Algorithms ; includes SHA1, 224, 256, 384, 512 (Python2/3) but also SHA3-224, -256, -384 and -512 (Python 3 only ; relies onhashlib) -
shake: aka SHAKE hashing (Python 3 only ; relies onhashlib)
⚠️ Hash functions are of course definitely NOT encoding functions ; they are implemented for convenience with the.encode(...)API fromcodecsand useful for chaning codecs.
-
braille: well-known braille language (Python 3 only) -
ipsum: aka lorem ipsum -
galactic: aka galactic alphabet or Minecraft enchantment language (Python 3 only) -
leetspeak: based on minimalistic elite speaking rules -
morse: uses whitespace as a separator -
navajo: only handles letters (not full words from the Navajo dictionary) -
radio: aka NATO or radio phonetic alphabet -
southpark: converts letters to Kenny's language from Southpark (whitespace is also handled) -
southpark-icase: case insensitive variant ofsouthpark -
tap: converts text to tap/knock code, commonly used by prisoners -
tomtom: similar tomorse, using slashes and backslashes
-
dna: implements the 8 rules of DNA sequences (N belongs to [1,8]) -
letter-indices: encodes consonants and/or vowels with their corresponding indices -
markdown: unidirectional encoding from Markdown to HTML
-
hexagram: uses Base64 and encodes the result to a charset of I Ching hexagrams (as implemented here) -
klopf: aka Klopf code ; Polybius square with trivial alphabetical distribution -
resistor: aka resistor color codes -
rick: aka Rick cipher (in reference to Rick Astley's song "Never gonna give you up") -
sms: also called T9 code ; uses "-" as a separator for encoding, "-" or "_" or whitespace for decoding -
whitespace: replaces bits with whitespaces and tabs -
whitespace_after_before: variant ofwhitespace; encodes characters as new characters with whitespaces before and after according to an equation described in the codec name (e.g. "whitespace+2*after-3*before")
-
html: implements entities according to this reference -
url: aka URL encoding



