Skip to content

Latest commit

 

History

History
350 lines (271 loc) · 18.8 KB

File metadata and controls

350 lines (271 loc) · 18.8 KB

CodExt Tweet

Encode/decode anything.

PyPi Read The Docs Build Status Coverage Status Python Versions Known Vulnerabilities DOI License

CodExt is a (Python2-3 compatible) library that extends the native codecs library (namely for adding new custom encodings and character mappings) and provides 120+ new codecs, hence its name combining CODecs EXTension. It also features a guess mode for decoding multiple layers of encoding and CLI tools for convenience.

$ pip install codext
Want to contribute a new codec ? Want to contribute a new macro ?
Check the documentation first
Then PR your new codec
PR your updated version of macros.json

🔍 Demonstrations

Using CodExt from the command line

Using base tools from the command line

Using the unbase command line tool

💻 Usage (main CLI tool) Tweet on codext

$ codext -i test.txt encode dna-1
GTGAGCGGGTATGTGA

$ echo -en "test" | codext encode morse
- . ... -

$ echo -en "test" | codext encode braille
⠞⠑⠎⠞

$ echo -en "test" | codext encode base100
👫👜👪👫

Chaining codecs

$ echo -en "Test string" | codext encode reverse
gnirts tseT

$ echo -en "Test string" | codext encode reverse morse
--. -. .. .-. - ... / - ... . -

$ echo -en "Test string" | codext encode reverse morse dna-2
AGTCAGTCAGTGAGAAAGTCAGTGAGAAAGTGAGTGAGAAAGTGAGTCAGTGAGAAAGTCAGAAAGTGAGTGAGTGAGAAAGTTAGAAAGTCAGAAAGTGAGTGAGTGAGAAAGTGAGAAAGTC

$ echo -en "Test string" | codext encode reverse morse dna-2 octal
101107124103101107124103101107124107101107101101101107124103101107124107101107101101101107124107101107124107101107101101101107124107101107124103101107124107101107101101101107124103101107101101101107124107101107124107101107124107101107101101101107124124101107101101101107124103101107101101101107124107101107124107101107124107101107101101101107124107101107101101101107124103

$ echo -en "AGTCAGTCAGTGAGAAAGTCAGTGAGAAAGTGAGTGAGAAAGTGAGTCAGTGAGAAAGTCAGAAAGTGAGTGAGTGAGAAAGTTAGAAAGTCAGAAAGTGAGTGAGTGAGAAAGTGAGAAAGTC" | codext -d dna-2 morse reverse
test string

Using macros

$ codext add-macro my-encoding-chain gzip base63 lzma base64

$ codext list macros
example-macro, my-encoding-chain

$ echo -en "Test string" | codext encode my-encoding-chain
CQQFAF0AAIAAABuTgySPa7WaZC5Sunt6FS0ko71BdrYE8zHqg91qaqadZIR2LafUzpeYDBalvE///ug4AA==

$ codext remove-macro my-encoding-chain

$ codext list macros
example-macro

💻 Usage (base CLI tool) Tweet on unbase

$ echo "Test string !" | base122
*.7!ft9�-f9Â

$ echo "Test string !" | base91 
"ONK;WDZM%Z%xE7L

$ echo "Test string !" | base91 | base85
B2P|BJ6A+nO(j|-cttl%

$ echo "Test string !" | base91 | base85 | base36 | base58-flickr
QVx5tvgjvCAkXaMSuKoQmCnjeCV1YyyR3WErUUErFf

$ echo "Test string !" | base91 | base85 | base36 | base58-flickr | base58-flickr -d | base36 -d | base85 -d | base91 -d
Test string !
$ echo "Test string !" | base91 | base85 | base36 | base58-flickr | unbase -m 3
Test string !

$ echo "Test string !" | base91 | base85 | base36 | base58-flickr | unbase -f Test
Test string !

💻 Usage (Python)

Getting the list of available codecs:

>>> import codext

>>> codext.list()
['ascii85', 'base85', 'base100', 'base122', ..., 'tomtom', 'dna', 'html', 'markdown', 'url', 'resistor', 'sms', 'whitespace', 'whitespace-after-before']

>>> codext.encode("this is a test", "base58-bitcoin")
'jo91waLQA1NNeBmZKUF'

>>> codext.encode("this is a test", "base58-ripple")
'jo9rA2LQwr44eBmZK7E'

>>> codext.encode("this is a test", "base58-url")
'JN91Wzkpa1nnDbLyjtf'

>>> codecs.encode("this is a test", "base100")
'👫👟👠👪🐗👠👪🐗👘🐗👫👜👪👫'

>>> codecs.decode("👫👟👠👪🐗👠👪🐗👘🐗👫👜👪👫", "base100")
'this is a test'

>>> for i in range(8):
        print(codext.encode("this is a test", "dna-%d" % (i + 1)))
GTGAGCCAGCCGGTATACAAGCCGGTATACAAGCAGACAAGTGAGCGGGTATGTGA
CTCACGGACGGCCTATAGAACGGCCTATAGAACGACAGAACTCACGCCCTATCTCA
ACAGATTGATTAACGCGTGGATTAACGCGTGGATGAGTGGACAGATAAACGCACAG
AGACATTCATTAAGCGCTCCATTAAGCGCTCCATCACTCCAGACATAAAGCGAGAC
TCTGTAAGTAATTCGCGAGGTAATTCGCGAGGTAGTGAGGTCTGTATTTCGCTCTG
TGTCTAACTAATTGCGCACCTAATTGCGCACCTACTCACCTGTCTATTTGCGTGTC
GAGTGCCTGCCGGATATCTTGCCGGATATCTTGCTGTCTTGAGTGCGGGATAGAGT
CACTCGGTCGGCCATATGTTCGGCCATATGTTCGTCTGTTCACTCGCCCATACACT
>>> codext.decode("GTGAGCCAGCCGGTATACAAGCCGGTATACAAGCAGACAAGTGAGCGGGTATGTGA", "dna-1")
'this is a test'

>>> codecs.encode("this is a test", "morse")
'- .... .. ... / .. ... / .- / - . ... -'

>>> codecs.decode("- .... .. ... / .. ... / .- / - . ... -", "morse")
'this is a test'

>>> with open("morse.txt", 'w', encoding="morse") as f:
	f.write("this is a test")
14

>>> with open("morse.txt",encoding="morse") as f:
	f.read()
'this is a test'

>>> codext.decode("""
      =            
              X         
   :            
      x         
  n  
    r 
        y   
      Y            
              y        
     p    
         a       
 `          
            n            
          |    
  a          
o    
       h        
          `            
          g               
           o 
   z      """, "whitespace-after+before")
'CSC{not_so_invisible}'

>>> print(codext.encode("An example test string", "baudot-tape"))
***.**
   . *
***.* 
*  .  
   .* 
*  .* 
   . *
** .* 
***.**
** .**
   .* 
*  .  
* *. *
   .* 
* *.  
* *. *
*  .  
* *.  
* *. *
***.  
  *.* 
***.* 
 * .* 

📃 List of codecs

  • base1: useless, but for the sake of completeness
  • base2: simple conversion to binary (with a variant with a reversed alphabet)
  • base3: conversion to ternary (with a variant with a reversed alphabet)
  • base4: conversion to quarternary (with a variant with a reversed alphabet)
  • base8: simple conversion to octal (with a variant with a reversed alphabet)
  • base10: simple conversion to decimal
  • base11: conversion to digits with a "a"
  • base16: simple conversion to hexadecimal (with a variant holding an alphabet with digits and letters inverted)
  • base26: conversion to alphabet letters
  • base32: classical conversion according to the RFC4648 with all its variants (zbase32, extended hexadecimal, geohash, Crockford)
  • base36: Base36 conversion to letters and digits (with a variant inverting both groups)
  • base45: Base45 DRAFT algorithm (with a variant inverting letters and digits)
  • base58: multiple versions of Base58 (bitcoin, flickr, ripple)
  • base62: Base62 conversion to lower- and uppercase letters and digits (with a variant with letters and digits inverted)
  • base63: similar to base62 with the "_" added
  • base64: classical conversion according to RFC4648 with its variant URL (or file) (it also holds a variant with letters and digits inverted)
  • base67: custom conversion using some more special characters (also with a variant with letters and digits inverted)
  • base85: all variants of Base85 (Ascii85, z85, Adobe, (x)btoa, RFC1924, XML)
  • base91: Base91 custom conversion
  • base100 (or emoji): Base100 custom conversion
  • base122: Base100 custom conversion
  • base-genericN: see base encodings ; supports any possible base

This category also contains ascii85, adobe, [x]btoa, zeromq with the base85 codec.

  • baudot: supports CCITT-1, CCITT-2, EU/FR, ITA1, ITA2, MTK-2 (Python3 only), UK, ...
  • baudot-spaced: variant of baudot ; groups of 5 bits are whitespace-separated
  • baudot-tape: variant of baudot ; outputs a string that looks like a perforated tape
  • bcd: Binary Coded Decimal, encodes characters from their (zero-left-padded) ordinals
  • bcd-extended0: variant of bcd ; encodes characters from their (zero-left-padded) ordinals using prefix bits 0000
  • bcd-extended1: variant of bcd ; encodes characters from their (zero-left-padded) ordinals using prefix bits 1111
  • excess3: uses Excess-3 (aka Stibitz code) binary encoding to convert characters from their ordinals
  • gray: aka reflected binary code
  • manchester: XORes each bit of the input with 01
  • manchester-inverted: variant of manchester ; XORes each bit of the input with 10
  • rotateN: rotates characters by the specified number of bits (N belongs to [1, 7] ; Python 3 only)
  • adler: Adler32 algorithm (relies on zlib)
  • crc: CRC of lengths 8, 10-17, 21, 24, 30-32, 40, 64, 82 with a variety of polynoms
  • luhn: Luhn mod N algorithm
  • a1z26: keeps words whitespace-separated and uses a custom character separator
  • cases: set of case-related encodings (including camel-, kebab-, lower-, pascal-, upper-, snake- and swap-case, slugify, capitalize, title)
  • dummy: set of simple encodings (including integer, replace, reverse, word-reverse, substite and strip-spaces)
  • octal: dummy octal conversion (converts to 3-digits groups)
  • octal-spaced: variant of octal ; dummy octal conversion, handling whitespace separators
  • ordinal: dummy character ordinals conversion (converts to 3-digits groups)
  • ordinal-spaced: variant of ordinal ; dummy character ordinals conversion, handling whitespace separators
  • gzip: standard Gzip compression/decompression
  • lz77: compresses the given data with the algorithm of Lempel and Ziv of 1977
  • lz78: compresses the given data with the algorithm of Lempel and Ziv of 1978
  • pkzip_deflate: standard Zip-deflate compression/decompression
  • pkzip_bzip2: standard BZip2 compression/decompression
  • pkzip_lzma: standard LZMA compression/decompression

⚠️ Compression functions are of course definitely NOT encoding functions ; they are implemented for leveraging the .encode(...) API from codecs.

  • affine: aka Affine Cipher
  • atbash: aka Atbash Cipher
  • bacon: aka Baconian Cipher
  • barbie-N: aka Barbie Typewriter (N belongs to [1, 4])
  • citrix: aka Citrix CTX1 password encoding
  • polybius: aka Polybius Square Cipher
  • railfence: aka Rail Fence Cipher
  • rotN: aka Caesar cipher (N belongs to [1,25])
  • scytaleN: encrypts using the number of letters on the rod (N belongs to [1,[)
  • shiftN: shift ordinals (N belongs to [1,255])
  • vigenere: aka Vigenere Cipher
  • xorN: XOR with a single byte (N belongs to [1,255])

⚠️ Crypto functions are of course definitely NOT encoding functions ; they are implemented for leveraging the .encode(...) API from codecs.

  • blake: includes BLAKE2b and BLAKE2s (Python 3 only ; relies on hashlib)
  • crypt: Unix's crypt hash for passwords (Python 3 and Unix only ; relies on crypt)
  • md: aka Message Digest ; includes MD4 and MD5 (relies on hashlib)
  • sha: aka Secure Hash Algorithms ; includes SHA1, 224, 256, 384, 512 (Python2/3) but also SHA3-224, -256, -384 and -512 (Python 3 only ; relies on hashlib)
  • shake: aka SHAKE hashing (Python 3 only ; relies on hashlib)

⚠️ Hash functions are of course definitely NOT encoding functions ; they are implemented for convenience with the .encode(...) API from codecs and useful for chaning codecs.

  • braille: well-known braille language (Python 3 only)
  • ipsum: aka lorem ipsum
  • galactic: aka galactic alphabet or Minecraft enchantment language (Python 3 only)
  • leetspeak: based on minimalistic elite speaking rules
  • morse: uses whitespace as a separator
  • navajo: only handles letters (not full words from the Navajo dictionary)
  • radio: aka NATO or radio phonetic alphabet
  • southpark: converts letters to Kenny's language from Southpark (whitespace is also handled)
  • southpark-icase: case insensitive variant of southpark
  • tap: converts text to tap/knock code, commonly used by prisoners
  • tomtom: similar to morse, using slashes and backslashes
  • dna: implements the 8 rules of DNA sequences (N belongs to [1,8])
  • letter-indices: encodes consonants and/or vowels with their corresponding indices
  • markdown: unidirectional encoding from Markdown to HTML
  • hexagram: uses Base64 and encodes the result to a charset of I Ching hexagrams (as implemented here)
  • klopf: aka Klopf code ; Polybius square with trivial alphabetical distribution
  • resistor: aka resistor color codes
  • rick: aka Rick cipher (in reference to Rick Astley's song "Never gonna give you up")
  • sms: also called T9 code ; uses "-" as a separator for encoding, "-" or "_" or whitespace for decoding
  • whitespace: replaces bits with whitespaces and tabs
  • whitespace_after_before: variant of whitespace ; encodes characters as new characters with whitespaces before and after according to an equation described in the codec name (e.g. "whitespace+2*after-3*before")
  • html: implements entities according to this reference
  • url: aka URL encoding

👏 Supporters

Stargazers repo roster for @dhondta/python-codext

Forkers repo roster for @dhondta/python-codext

Back to top