Add sponsor badge

Author: hyperpolymath

README.md

@@ -0,0 +1,261 @@
+[![Sponsor](https://img.shields.io/badge/Sponsor-%E2%9D%A4-pink?logo=github)](https://github.com/sponsors/hyperpolymath)
+
+// SPDX-License-Identifier: MPL-2.0
+// SPDX-FileCopyrightText: 2026 Jonathan D.A. Jewell <j.d.a.jewell@open.ac.uk>
+
+= Cladistics.jl
+:toc: preamble
+:icons: font
+
+image:https://img.shields.io/badge/OpenSSF-Best_Practices-green?logo=opensourcesecurity[OpenSSF Best Practices,link="https://www.bestpractices.dev/en/projects/new?repo_url=https://github.com/hyperpolymath/Cladistics.jl"]
+image:https://img.shields.io/badge/License-PMPL--1.0-blue.svg[License: PMPL-1.0,link="https://github.com/hyperpolymath/palimpsest-license"]
+image:https://api.thegreenwebfoundation.org/greencheckimage/github.com[Green Web,link="https://www.thegreenwebfoundation.org/green-web-check/?url=github.com"]
+image:https://img.shields.io/badge/Project-Topology-9558B2[Project Topology,link="TOPOLOGY.md"]
+image:https://img.shields.io/badge/Completion-75%25-yellow[Completion Status,link="TOPOLOGY.md"]
+image:https://img.shields.io/badge/license-PMPL--1.0--or--later-blue.svg[License,link="LICENSE"]
+image:https://img.shields.io/badge/julia-1.6+-purple.svg[Julia,link="https://julialang.org"]
+
+A Julia package for phylogenetic analysis and cladistics — the study of
+evolutionary relationships among organisms.
+
+== Overview
+
+Cladistics is a method of biological classification that groups organisms based
+on their evolutionary ancestry and shared derived characteristics (synapomorphies).
+This package provides computational tools for reconstructing and analyzing
+phylogenetic trees from molecular sequence data and morphological characters.
+
+=== What is Cladistics?
+
+* *Clade*: A monophyletic group consisting of an ancestor and all its descendants
+* *Synapomorphy*: A shared derived characteristic that defines a clade
+* *Phylogenetic Tree*: A branching diagram showing evolutionary relationships
+* *Parsimony*: The principle that the simplest evolutionary explanation (fewest changes) is preferred
+* *Bootstrap Analysis*: Statistical method to assess confidence in tree topology
+
+== Features
+
+=== Distance-Based Methods
+
+* *Multiple Distance Metrics*: Hamming, p-distance, Jukes-Cantor 1969, Kimura 2-parameter
+* *UPGMA*: Unweighted Pair Group Method with Arithmetic Mean (assumes molecular clock)
+* *Neighbor-Joining*: Does not assume molecular clock, handles rate variation
+
+=== Character-Based Methods
+
+* *Maximum Parsimony*: Find trees requiring fewest evolutionary changes
+* *Fitch Algorithm*: Efficient parsimony score calculation
+* *Parsimony-Informative Sites*: Identify characters useful for phylogenetic inference
+
+=== Tree Analysis
+
+* *Bootstrap Support*: Assess confidence in tree topology (1000+ replicates)
+* *Clade Identification*: Extract well-supported monophyletic groups
+* *Robinson-Foulds Distance*: Compare tree topologies quantitatively
+* *Tree Rooting*: Root unrooted trees using outgroup taxa
+* *Newick Format*: Export trees in standard phylogenetic format
+
+== Installation
+
+[source,julia]
+----
+using Pkg
+Pkg.add("Cladistics")
+----
+
+== Quick Start
+
+[source,julia]
+----
+using Cladistics
+using Plots
+
+# 1. DNA sequence data (aligned)
+sequences = [
+    "ATCGATCGATCG",  # Species A
+    "ATCGATCGATCG",  # Species B (same as A)
+    "ATCGTTCGATCG",  # Species C
+    "TTCGATCGATCG",  # Species D
+    "TTCGTTCGATCC"   # Species E (outgroup)
+]
+taxa_names = ["Species_A", "Species_B", "Species_C", "Species_D", "Species_E"]
+
+# 2. Calculate evolutionary distances
+dmat = distance_matrix(sequences, method=:jc69)
+
+# 3. Build phylogenetic tree using UPGMA
+upgma_tree = upgma(dmat, taxa_names=taxa_names)
+newick = tree_to_newick(upgma_tree)
+
+# 4. Build tree using Neighbor-Joining
+nj_tree = neighbor_joining(dmat, taxa_names=taxa_names)
+
+# 5. Compare tree topologies
+rf_distance = tree_distance(upgma_tree, nj_tree)
+
+# 6. Bootstrap analysis for confidence
+support = bootstrap_support(sequences, replicates=1000, method=:nj)
+
+# 7. Identify well-supported clades
+clades = identify_clades(upgma_tree, 0.95)
+----
+
+== Distance Methods Comparison
+
+[source,julia]
+----
+using Cladistics
+sequences = ["ATCG", "ATCG", "TTCG", "TTCC"]
+
+hamming = distance_matrix(sequences, method=:hamming)   # Simple counting
+p_dist  = distance_matrix(sequences, method=:p_distance) # Proportion of differences
+jc69    = distance_matrix(sequences, method=:jc69)       # Jukes-Cantor
+k2p     = distance_matrix(sequences, method=:k2p)        # Kimura 2-parameter
+----
+
+== Tree Construction Methods
+
+=== UPGMA: Simple but assumes molecular clock
+
+[source,julia]
+----
+dmat = [0.0 0.2 0.4; 0.2 0.0 0.3; 0.4 0.3 0.0]
+tree = upgma(dmat, taxa_names=["Human", "Chimp", "Gorilla"])
+# Good for: recent divergences, molecular clock valid
+# Not good for: ancient divergences, variable rates
+----
+
+=== Neighbor-Joining: No molecular clock assumption
+
+[source,julia]
+----
+dmat = [0.0 0.5 0.8 1.0; 0.5 0.0 0.6 0.9; 0.8 0.6 0.0 0.4; 1.0 0.9 0.4 0.0]
+tree = neighbor_joining(dmat, taxa_names=["A", "B", "C", "D"])
+# Good for: variable evolutionary rates, large datasets
+----
+
+== Bootstrap Analysis
+
+[source,julia]
+----
+using Cladistics, Random
+Random.seed!(42)
+sequences = [
+    "ATCGATCGATCGATCG",
+    "ATCGATCGATCGATCG",
+    "ATCGTTCGATCGATCG",
+    "TTCGATCGATCGATCG",
+    "TTCGTTCGATCGTTCC"
+]
+# 1000 bootstrap replicates — resamples alignment columns with replacement
+support = bootstrap_support(sequences, replicates=1000, method=:nj)
+# Interpret: >95% Strong, 70-95% Moderate, <70% Weak
+----
+
+== Maximum Parsimony
+
+[source,julia]
+----
+using Cladistics
+alignment = ["ATCG", "ATCG", "TTCG", "TTCC"]
+char_matrix = character_state_matrix(alignment)
+informative_sites = parsimony_informative_sites(char_matrix)
+dmat = distance_matrix(alignment, method=:hamming)
+tree = upgma(dmat, taxa_names=["Tax1", "Tax2", "Tax3", "Tax4"])
+score = calculate_parsimony_score(tree, char_matrix)
+# Lower score = more parsimonious (preferred)
+----
+
+== Real-World Example: Primate Phylogeny
+
+[source,julia]
+----
+using Cladistics
+primate_sequences = [
+    "ATCGATCGATCGATCGATCG",  # Human
+    "ATCGATCGATCGATCGATCG",  # Chimp
+    "ATCGATCGTTCGATCGATCG",  # Gorilla
+    "ATCGTTCGTTCGATCGTTCG",  # Orangutan
+    "TTCGTTCGTTCGTTCGTTCG"   # Lemur (outgroup)
+]
+taxa = ["Human", "Chimp", "Gorilla", "Orangutan", "Lemur"]
+dmat = distance_matrix(primate_sequences, method=:k2p)
+tree = neighbor_joining(dmat, taxa_names=taxa)
+rooted_tree = root_tree(tree, "Lemur")
+support = bootstrap_support(primate_sequences, replicates=100, method=:nj)
+newick = tree_to_newick(rooted_tree)
+----
+
+== Key Concepts
+
+=== Molecular Clock
+
+* Assumption: constant evolutionary rate across lineages
+* When valid: recent species, similar generation times
+* Methods: UPGMA assumes molecular clock
+* When violated: use Neighbor-Joining
+
+=== Bootstrap Support Interpretation
+
+* `>95%`: Publish with confidence
+* `70–95%`: Mention uncertainty
+* `<70%`: Weak support, collect more data
+
+=== Parsimony vs Distance
+
+* *Parsimony*: Find tree requiring fewest character changes; NP-hard but theoretically clear
+* *Distance*: Fast, scales to large datasets; loses some information from pairwise comparisons
+
+== References
+
+=== Classic Papers
+
+* Felsenstein, J. (1985). "Confidence limits on phylogenies: An approach using the bootstrap." _Evolution_, 39(4), 783–791.
+* Saitou, N., & Nei, M. (1987). "The neighbor-joining method." _Molecular Biology and Evolution_, 4(4), 406–425.
+* Fitch, W. M. (1971). "Toward defining the course of evolution." _Systematic Zoology_, 20(4), 406–416.
+
+=== Textbooks
+
+* Felsenstein, J. (2004). _Inferring Phylogenies_. Sinauer Associates.
+* Lemey, P. et al. (2009). _The Phylogenetic Handbook_. Cambridge University Press.
+* Hall, B. G. (2011). _Phylogenetic Trees Made Easy_. Sinauer Associates.
+
+=== Evolutionary Models
+
+* Jukes, T. H., & Cantor, C. R. (1969). "Evolution of protein molecules." _Mammalian Protein Metabolism_, pp. 21–132.
+* Kimura, M. (1980). "A simple method for estimating evolutionary rates." _Journal of Molecular Evolution_, 16(2), 111–120.
+
+== Citation
+
+[source,bibtex]
+----
+@software{cladistics_jl,
+  author = {Jewell, Jonathan D.A.},
+  title = {Cladistics.jl: Phylogenetic Analysis in Julia},
+  year = {2026},
+  url = {https://github.com/hyperpolymath/Cladistics.jl}
+}
+----
+
+== Related Projects
+
+* https://github.com/BioJulia[BioJulia] — Broader bioinformatics ecosystem
+* https://github.com/crsl4/PhyloNetworks.jl[PhyloNetworks.jl] — Phylogenetic networks
+* https://github.com/richardreeve/Phylo.jl[Phylo.jl] — Alternative phylogenetics package
+
+== External Visualization Tools
+
+* http://tree.bio.ed.ac.uk/software/figtree/[FigTree]
+* https://itol.embl.de/[iTOL]
+* http://etetoolkit.org/[ETE Toolkit]
+
+== Contributing
+
+See link:CONTRIBUTING.md[CONTRIBUTING.md] for guidelines.
+
+Wondering how this works? See link:EXPLAINME.adoc[].
+
+== License
+
+SPDX-License-Identifier: MPL-2.0 +
+See link:LICENSE[LICENSE].