|
| 1 | +[](https://github.com/sponsors/hyperpolymath) |
| 2 | + |
| 3 | +// SPDX-License-Identifier: MPL-2.0 |
| 4 | +// SPDX-FileCopyrightText: 2026 Jonathan D.A. Jewell <j.d.a.jewell@open.ac.uk> |
| 5 | + |
| 6 | += Cladistics.jl |
| 7 | +:toc: preamble |
| 8 | +:icons: font |
| 9 | + |
| 10 | +image:https://img.shields.io/badge/OpenSSF-Best_Practices-green?logo=opensourcesecurity[OpenSSF Best Practices,link="https://www.bestpractices.dev/en/projects/new?repo_url=https://github.com/hyperpolymath/Cladistics.jl"] |
| 11 | +image:https://img.shields.io/badge/License-PMPL--1.0-blue.svg[License: PMPL-1.0,link="https://github.com/hyperpolymath/palimpsest-license"] |
| 12 | +image:https://api.thegreenwebfoundation.org/greencheckimage/github.com[Green Web,link="https://www.thegreenwebfoundation.org/green-web-check/?url=github.com"] |
| 13 | +image:https://img.shields.io/badge/Project-Topology-9558B2[Project Topology,link="TOPOLOGY.md"] |
| 14 | +image:https://img.shields.io/badge/Completion-75%25-yellow[Completion Status,link="TOPOLOGY.md"] |
| 15 | +image:https://img.shields.io/badge/license-PMPL--1.0--or--later-blue.svg[License,link="LICENSE"] |
| 16 | +image:https://img.shields.io/badge/julia-1.6+-purple.svg[Julia,link="https://julialang.org"] |
| 17 | + |
| 18 | +A Julia package for phylogenetic analysis and cladistics — the study of |
| 19 | +evolutionary relationships among organisms. |
| 20 | + |
| 21 | +== Overview |
| 22 | + |
| 23 | +Cladistics is a method of biological classification that groups organisms based |
| 24 | +on their evolutionary ancestry and shared derived characteristics (synapomorphies). |
| 25 | +This package provides computational tools for reconstructing and analyzing |
| 26 | +phylogenetic trees from molecular sequence data and morphological characters. |
| 27 | + |
| 28 | +=== What is Cladistics? |
| 29 | + |
| 30 | +* *Clade*: A monophyletic group consisting of an ancestor and all its descendants |
| 31 | +* *Synapomorphy*: A shared derived characteristic that defines a clade |
| 32 | +* *Phylogenetic Tree*: A branching diagram showing evolutionary relationships |
| 33 | +* *Parsimony*: The principle that the simplest evolutionary explanation (fewest changes) is preferred |
| 34 | +* *Bootstrap Analysis*: Statistical method to assess confidence in tree topology |
| 35 | + |
| 36 | +== Features |
| 37 | + |
| 38 | +=== Distance-Based Methods |
| 39 | + |
| 40 | +* *Multiple Distance Metrics*: Hamming, p-distance, Jukes-Cantor 1969, Kimura 2-parameter |
| 41 | +* *UPGMA*: Unweighted Pair Group Method with Arithmetic Mean (assumes molecular clock) |
| 42 | +* *Neighbor-Joining*: Does not assume molecular clock, handles rate variation |
| 43 | + |
| 44 | +=== Character-Based Methods |
| 45 | + |
| 46 | +* *Maximum Parsimony*: Find trees requiring fewest evolutionary changes |
| 47 | +* *Fitch Algorithm*: Efficient parsimony score calculation |
| 48 | +* *Parsimony-Informative Sites*: Identify characters useful for phylogenetic inference |
| 49 | + |
| 50 | +=== Tree Analysis |
| 51 | + |
| 52 | +* *Bootstrap Support*: Assess confidence in tree topology (1000+ replicates) |
| 53 | +* *Clade Identification*: Extract well-supported monophyletic groups |
| 54 | +* *Robinson-Foulds Distance*: Compare tree topologies quantitatively |
| 55 | +* *Tree Rooting*: Root unrooted trees using outgroup taxa |
| 56 | +* *Newick Format*: Export trees in standard phylogenetic format |
| 57 | + |
| 58 | +== Installation |
| 59 | + |
| 60 | +[source,julia] |
| 61 | +---- |
| 62 | +using Pkg |
| 63 | +Pkg.add("Cladistics") |
| 64 | +---- |
| 65 | + |
| 66 | +== Quick Start |
| 67 | + |
| 68 | +[source,julia] |
| 69 | +---- |
| 70 | +using Cladistics |
| 71 | +using Plots |
| 72 | + |
| 73 | +# 1. DNA sequence data (aligned) |
| 74 | +sequences = [ |
| 75 | + "ATCGATCGATCG", # Species A |
| 76 | + "ATCGATCGATCG", # Species B (same as A) |
| 77 | + "ATCGTTCGATCG", # Species C |
| 78 | + "TTCGATCGATCG", # Species D |
| 79 | + "TTCGTTCGATCC" # Species E (outgroup) |
| 80 | +] |
| 81 | +taxa_names = ["Species_A", "Species_B", "Species_C", "Species_D", "Species_E"] |
| 82 | + |
| 83 | +# 2. Calculate evolutionary distances |
| 84 | +dmat = distance_matrix(sequences, method=:jc69) |
| 85 | + |
| 86 | +# 3. Build phylogenetic tree using UPGMA |
| 87 | +upgma_tree = upgma(dmat, taxa_names=taxa_names) |
| 88 | +newick = tree_to_newick(upgma_tree) |
| 89 | + |
| 90 | +# 4. Build tree using Neighbor-Joining |
| 91 | +nj_tree = neighbor_joining(dmat, taxa_names=taxa_names) |
| 92 | + |
| 93 | +# 5. Compare tree topologies |
| 94 | +rf_distance = tree_distance(upgma_tree, nj_tree) |
| 95 | + |
| 96 | +# 6. Bootstrap analysis for confidence |
| 97 | +support = bootstrap_support(sequences, replicates=1000, method=:nj) |
| 98 | + |
| 99 | +# 7. Identify well-supported clades |
| 100 | +clades = identify_clades(upgma_tree, 0.95) |
| 101 | +---- |
| 102 | + |
| 103 | +== Distance Methods Comparison |
| 104 | + |
| 105 | +[source,julia] |
| 106 | +---- |
| 107 | +using Cladistics |
| 108 | +sequences = ["ATCG", "ATCG", "TTCG", "TTCC"] |
| 109 | + |
| 110 | +hamming = distance_matrix(sequences, method=:hamming) # Simple counting |
| 111 | +p_dist = distance_matrix(sequences, method=:p_distance) # Proportion of differences |
| 112 | +jc69 = distance_matrix(sequences, method=:jc69) # Jukes-Cantor |
| 113 | +k2p = distance_matrix(sequences, method=:k2p) # Kimura 2-parameter |
| 114 | +---- |
| 115 | + |
| 116 | +== Tree Construction Methods |
| 117 | + |
| 118 | +=== UPGMA: Simple but assumes molecular clock |
| 119 | + |
| 120 | +[source,julia] |
| 121 | +---- |
| 122 | +dmat = [0.0 0.2 0.4; 0.2 0.0 0.3; 0.4 0.3 0.0] |
| 123 | +tree = upgma(dmat, taxa_names=["Human", "Chimp", "Gorilla"]) |
| 124 | +# Good for: recent divergences, molecular clock valid |
| 125 | +# Not good for: ancient divergences, variable rates |
| 126 | +---- |
| 127 | + |
| 128 | +=== Neighbor-Joining: No molecular clock assumption |
| 129 | + |
| 130 | +[source,julia] |
| 131 | +---- |
| 132 | +dmat = [0.0 0.5 0.8 1.0; 0.5 0.0 0.6 0.9; 0.8 0.6 0.0 0.4; 1.0 0.9 0.4 0.0] |
| 133 | +tree = neighbor_joining(dmat, taxa_names=["A", "B", "C", "D"]) |
| 134 | +# Good for: variable evolutionary rates, large datasets |
| 135 | +---- |
| 136 | + |
| 137 | +== Bootstrap Analysis |
| 138 | + |
| 139 | +[source,julia] |
| 140 | +---- |
| 141 | +using Cladistics, Random |
| 142 | +Random.seed!(42) |
| 143 | +sequences = [ |
| 144 | + "ATCGATCGATCGATCG", |
| 145 | + "ATCGATCGATCGATCG", |
| 146 | + "ATCGTTCGATCGATCG", |
| 147 | + "TTCGATCGATCGATCG", |
| 148 | + "TTCGTTCGATCGTTCC" |
| 149 | +] |
| 150 | +# 1000 bootstrap replicates — resamples alignment columns with replacement |
| 151 | +support = bootstrap_support(sequences, replicates=1000, method=:nj) |
| 152 | +# Interpret: >95% Strong, 70-95% Moderate, <70% Weak |
| 153 | +---- |
| 154 | + |
| 155 | +== Maximum Parsimony |
| 156 | + |
| 157 | +[source,julia] |
| 158 | +---- |
| 159 | +using Cladistics |
| 160 | +alignment = ["ATCG", "ATCG", "TTCG", "TTCC"] |
| 161 | +char_matrix = character_state_matrix(alignment) |
| 162 | +informative_sites = parsimony_informative_sites(char_matrix) |
| 163 | +dmat = distance_matrix(alignment, method=:hamming) |
| 164 | +tree = upgma(dmat, taxa_names=["Tax1", "Tax2", "Tax3", "Tax4"]) |
| 165 | +score = calculate_parsimony_score(tree, char_matrix) |
| 166 | +# Lower score = more parsimonious (preferred) |
| 167 | +---- |
| 168 | + |
| 169 | +== Real-World Example: Primate Phylogeny |
| 170 | + |
| 171 | +[source,julia] |
| 172 | +---- |
| 173 | +using Cladistics |
| 174 | +primate_sequences = [ |
| 175 | + "ATCGATCGATCGATCGATCG", # Human |
| 176 | + "ATCGATCGATCGATCGATCG", # Chimp |
| 177 | + "ATCGATCGTTCGATCGATCG", # Gorilla |
| 178 | + "ATCGTTCGTTCGATCGTTCG", # Orangutan |
| 179 | + "TTCGTTCGTTCGTTCGTTCG" # Lemur (outgroup) |
| 180 | +] |
| 181 | +taxa = ["Human", "Chimp", "Gorilla", "Orangutan", "Lemur"] |
| 182 | +dmat = distance_matrix(primate_sequences, method=:k2p) |
| 183 | +tree = neighbor_joining(dmat, taxa_names=taxa) |
| 184 | +rooted_tree = root_tree(tree, "Lemur") |
| 185 | +support = bootstrap_support(primate_sequences, replicates=100, method=:nj) |
| 186 | +newick = tree_to_newick(rooted_tree) |
| 187 | +---- |
| 188 | + |
| 189 | +== Key Concepts |
| 190 | + |
| 191 | +=== Molecular Clock |
| 192 | + |
| 193 | +* Assumption: constant evolutionary rate across lineages |
| 194 | +* When valid: recent species, similar generation times |
| 195 | +* Methods: UPGMA assumes molecular clock |
| 196 | +* When violated: use Neighbor-Joining |
| 197 | + |
| 198 | +=== Bootstrap Support Interpretation |
| 199 | + |
| 200 | +* `>95%`: Publish with confidence |
| 201 | +* `70–95%`: Mention uncertainty |
| 202 | +* `<70%`: Weak support, collect more data |
| 203 | + |
| 204 | +=== Parsimony vs Distance |
| 205 | + |
| 206 | +* *Parsimony*: Find tree requiring fewest character changes; NP-hard but theoretically clear |
| 207 | +* *Distance*: Fast, scales to large datasets; loses some information from pairwise comparisons |
| 208 | + |
| 209 | +== References |
| 210 | + |
| 211 | +=== Classic Papers |
| 212 | + |
| 213 | +* Felsenstein, J. (1985). "Confidence limits on phylogenies: An approach using the bootstrap." _Evolution_, 39(4), 783–791. |
| 214 | +* Saitou, N., & Nei, M. (1987). "The neighbor-joining method." _Molecular Biology and Evolution_, 4(4), 406–425. |
| 215 | +* Fitch, W. M. (1971). "Toward defining the course of evolution." _Systematic Zoology_, 20(4), 406–416. |
| 216 | + |
| 217 | +=== Textbooks |
| 218 | + |
| 219 | +* Felsenstein, J. (2004). _Inferring Phylogenies_. Sinauer Associates. |
| 220 | +* Lemey, P. et al. (2009). _The Phylogenetic Handbook_. Cambridge University Press. |
| 221 | +* Hall, B. G. (2011). _Phylogenetic Trees Made Easy_. Sinauer Associates. |
| 222 | + |
| 223 | +=== Evolutionary Models |
| 224 | + |
| 225 | +* Jukes, T. H., & Cantor, C. R. (1969). "Evolution of protein molecules." _Mammalian Protein Metabolism_, pp. 21–132. |
| 226 | +* Kimura, M. (1980). "A simple method for estimating evolutionary rates." _Journal of Molecular Evolution_, 16(2), 111–120. |
| 227 | + |
| 228 | +== Citation |
| 229 | + |
| 230 | +[source,bibtex] |
| 231 | +---- |
| 232 | +@software{cladistics_jl, |
| 233 | + author = {Jewell, Jonathan D.A.}, |
| 234 | + title = {Cladistics.jl: Phylogenetic Analysis in Julia}, |
| 235 | + year = {2026}, |
| 236 | + url = {https://github.com/hyperpolymath/Cladistics.jl} |
| 237 | +} |
| 238 | +---- |
| 239 | + |
| 240 | +== Related Projects |
| 241 | + |
| 242 | +* https://github.com/BioJulia[BioJulia] — Broader bioinformatics ecosystem |
| 243 | +* https://github.com/crsl4/PhyloNetworks.jl[PhyloNetworks.jl] — Phylogenetic networks |
| 244 | +* https://github.com/richardreeve/Phylo.jl[Phylo.jl] — Alternative phylogenetics package |
| 245 | + |
| 246 | +== External Visualization Tools |
| 247 | + |
| 248 | +* http://tree.bio.ed.ac.uk/software/figtree/[FigTree] |
| 249 | +* https://itol.embl.de/[iTOL] |
| 250 | +* http://etetoolkit.org/[ETE Toolkit] |
| 251 | + |
| 252 | +== Contributing |
| 253 | + |
| 254 | +See link:CONTRIBUTING.md[CONTRIBUTING.md] for guidelines. |
| 255 | + |
| 256 | +Wondering how this works? See link:EXPLAINME.adoc[]. |
| 257 | + |
| 258 | +== License |
| 259 | + |
| 260 | +SPDX-License-Identifier: MPL-2.0 + |
| 261 | +See link:LICENSE[LICENSE]. |
0 commit comments